EMAIL THIS PAGE TO A FRIEND

RAB27A

RAB27A, member RAS oncogene family

139 Gene Product Result for
Synonyms: GS2 HsT18676 RAB27 RAM
UniProtKB ID: P51159, O00195, Q6FI40, Q9UIR9, Q9Y5U3
Gene ID:
Human(5873) Summary: The protein encoded by this gene belongs to the small GTPase superfamily, Rab family. The protein is membrane-bound and may be involved in protein transport and small GTPase mediated signal transduction. Mutations in this gene are associated with Griscelli syndrome type 2. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(11891) RAB27A, member RAS oncogene family
Rat(50645) RAB27A, member RAS oncogene family
Zebrafish(570907) RAB27A, member RAS oncogene family
chicken(415410) RAB27A, member RAS oncogene family
domestic cat(101086976) RAB27A, member RAS oncogene family
dog(608699) RAB27A, member RAS oncogene family
cow(618035) RAB27A, member RAS oncogene family
sheep(101122791) RAB27A, member RAS oncogene family
naked mole-rat(101718718) RAB27A, member RAS oncogene family
domestic guinea pig(100720981) RAB27A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004580 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004580 Rosetta Predictions human pricing
NM_183234 Rosetta Predictions human pricing
NM_183235 Rosetta Predictions human pricing
NM_183236 Rosetta Predictions human pricing
NM_017317 Rosetta Predictions rat pricing
NM_023635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172591 predicted 1024
2 SASI_Hs01_00172592 predicted 952
3 SASI_Hs01_00172593 predicted 1194
4 SASI_Hs01_00172594 predicted 1033
5 SASI_Hs01_00172595 predicted 768
6 SASI_Hs01_00172596 predicted 592
7 SASI_Hs01_00172598 predicted 740
8 SASI_Hs01_00172599 predicted 947
9 SASI_Hs01_00172600 predicted 857
10 SASI_Hs02_00337923 predicted 487
11 SASI_Hs01_00172597 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082987 predicted 1018
2 SASI_Hs01_00082988 predicted 935
3 SASI_Hs01_00082989 predicted 1185
4 SASI_Hs01_00082990 predicted 1027
5 SASI_Hs01_00082991 predicted 752
6 SASI_Hs01_00082992 predicted 585
7 SASI_Hs01_00082994 predicted 731
8 SASI_Hs01_00082995 predicted 937
9 SASI_Hs01_00082996 predicted 853
10 SASI_Hs02_00371232 predicted 475
11 SASI_Hs01_00082993 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220652 predicted 1015
2 SASI_Hs01_00220653 predicted 931
3 SASI_Hs01_00220654 predicted 1183
4 SASI_Hs01_00220655 predicted 1024
5 SASI_Hs01_00220656 predicted 751
6 SASI_Hs01_00220657 predicted 579
7 SASI_Hs01_00220659 predicted 729
8 SASI_Hs01_00220660 predicted 934
9 SASI_Hs01_00220661 predicted 851
10 SASI_Hs02_00371233 predicted 467
11 SASI_Hs01_00220658 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143515 predicted 969
2 SASI_Hs01_00143516 predicted 895
3 SASI_Hs01_00143517 predicted 1141
4 SASI_Hs01_00143518 predicted 990
5 SASI_Hs01_00143519 predicted 710
6 SASI_Hs01_00143520 predicted 539
7 SASI_Hs01_00143522 predicted 687
8 SASI_Hs01_00143523 predicted 901
9 SASI_Hs01_00143524 predicted 809
10 SASI_Hs02_00371234 predicted 434
11 SASI_Hs01_00143521 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041045 predicted 1173
2 SASI_Rn01_00041046 predicted 225
3 SASI_Rn01_00041047 predicted 335
4 SASI_Rn01_00041048 predicted 1177
5 SASI_Rn02_00261767 predicted 579
6 SASI_Rn01_00041049 predicted 319
7 SASI_Rn01_00041051 predicted 463
8 SASI_Rn01_00041053 predicted 1226
9 SASI_Rn01_00041054 predicted 1164
10 SASI_Rn02_00261768 predicted 670
11 SASI_Rn01_00041050 predicted 508
12 SASI_Rn01_00041052 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327245 predicted 683
2 SASI_Mm02_00327246 predicted 1306
3 SASI_Mm02_00327247 predicted 1245
4 SASI_Mm02_00327248 predicted 1078
5 SASI_Mm02_00327249 predicted 421
6 SASI_Mm02_00327250 predicted 1107
7 SASI_Mm02_00327251 predicted 1275
8 SASI_Mm02_00327252 predicted 539
9 SASI_Mm02_00327253 predicted 1094
10 SASI_Mm02_00327254 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023635
VALIDATED
RAB27A MISSION shRNA Bacterial Glycerol Stock
RAB27A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023635.5-1200s21c1
Sequence:GTACCGGAGTCTCATTGAAGACATTAAGCTCGAGCTTAATGTCTTCAATGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-402s21c1
Sequence:GTACCGGAGGAGAGGTTTCGTAGCTTAACTCGAGTTAAGCTACGAAACCTCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023635.5-1288s21c1
Sequence:GTACCGGTCACTCTCAAACACGTGAATGCTCGAGCATTCACGTGTTTGAGAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-672s21c1
Sequence:GTACCGGCAAACATAAGCCACGCGATTGCTCGAGCAATCGCGTGGCTTATGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-695s21c1
Sequence:GTACCGGATGCTCCTGGACCTGATCATGCTCGAGCATGATCAGGTCCAGGAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-1870s1c1
Sequence:CCGGGCCAGTTTAAGAGAAGTGTTTCTCGAGAAACACTTCTCTTAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023635.2-502s1c1
Sequence:CCGGCGAAACTGGATAAGCCAGCTACTCGAGTAGCTGGCTTATCCAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-459s1c1
Sequence:CCGGGCTTCTGTTCGACCTGACAAACTCGAGTTTGTCAGGTCGAACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-252s1c1
Sequence:CCGGCCAGTACACTGATGGCAAGTTCTCGAGAACTTGCCATCAGTGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023635.2-672s1c1
Sequence:CCGGGACAAACATAAGCCACGCGATCTCGAGATCGCGTGGCTTATGTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023635
VALIDATED
RAB27A MISSION shRNA shRNA Plasmid DNA
RAB27A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023635.5-1200s21c1
Sequence:GTACCGGAGTCTCATTGAAGACATTAAGCTCGAGCTTAATGTCTTCAATGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-402s21c1
Sequence:GTACCGGAGGAGAGGTTTCGTAGCTTAACTCGAGTTAAGCTACGAAACCTCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023635.5-1288s21c1
Sequence:GTACCGGTCACTCTCAAACACGTGAATGCTCGAGCATTCACGTGTTTGAGAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-672s21c1
Sequence:GTACCGGCAAACATAAGCCACGCGATTGCTCGAGCAATCGCGTGGCTTATGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-695s21c1
Sequence:GTACCGGATGCTCCTGGACCTGATCATGCTCGAGCATGATCAGGTCCAGGAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-1870s1c1
Sequence:CCGGGCCAGTTTAAGAGAAGTGTTTCTCGAGAAACACTTCTCTTAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023635.2-502s1c1
Sequence:CCGGCGAAACTGGATAAGCCAGCTACTCGAGTAGCTGGCTTATCCAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-459s1c1
Sequence:CCGGGCTTCTGTTCGACCTGACAAACTCGAGTTTGTCAGGTCGAACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-252s1c1
Sequence:CCGGCCAGTACACTGATGGCAAGTTCTCGAGAACTTGCCATCAGTGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023635.2-672s1c1
Sequence:CCGGGACAAACATAAGCCACGCGATCTCGAGATCGCGTGGCTTATGTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023635
VALIDATED
RAB27A MISSION shRNA Lentiviral Transduction Particles
RAB27A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023635.5-1200s21c1
Sequence:GTACCGGAGTCTCATTGAAGACATTAAGCTCGAGCTTAATGTCTTCAATGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-402s21c1
Sequence:GTACCGGAGGAGAGGTTTCGTAGCTTAACTCGAGTTAAGCTACGAAACCTCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023635.5-1288s21c1
Sequence:GTACCGGTCACTCTCAAACACGTGAATGCTCGAGCATTCACGTGTTTGAGAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-672s21c1
Sequence:GTACCGGCAAACATAAGCCACGCGATTGCTCGAGCAATCGCGTGGCTTATGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023635.5-695s21c1
Sequence:GTACCGGATGCTCCTGGACCTGATCATGCTCGAGCATGATCAGGTCCAGGAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-1870s1c1
Sequence:CCGGGCCAGTTTAAGAGAAGTGTTTCTCGAGAAACACTTCTCTTAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023635.2-502s1c1
Sequence:CCGGCGAAACTGGATAAGCCAGCTACTCGAGTAGCTGGCTTATCCAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-459s1c1
Sequence:CCGGGCTTCTGTTCGACCTGACAAACTCGAGTTTGTCAGGTCGAACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023635.2-252s1c1
Sequence:CCGGCCAGTACACTGATGGCAAGTTCTCGAGAACTTGCCATCAGTGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023635.2-672s1c1
Sequence:CCGGGACAAACATAAGCCACGCGATCTCGAGATCGCGTGGCTTATGTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004580
VALIDATED
RAB27A MISSION shRNA Bacterial Glycerol Stock
RAB27A, member RAS oncogene family
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-313s21c1
Sequence:CCGGCCAGTGTACTTTACCAATATACTCGAGTATATTGGTAAAGTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004580.3-865s21c1
Sequence:CCGGCGGATCAGTTAAGTGAAGAAACTCGAGTTTCTTCACTTAACTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004580.3-735s21c1
Sequence:CCGGGCTGCCAATGGGACAAACATACTCGAGTATGTTTGTCCCATTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-477s21c1
Sequence:CCGGCAGGAGAGGTTTCGTAGCTTACTCGAGTAAGCTACGAAACCTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-831s21c1
Sequence:GTACCGGGAAGGAGTGGTGCGATCAAATCTCGAGATTTGATCGCACCACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-362s21c1
Sequence:GTACCGGCACAACAGTGGGCATTGATTTCTCGAGAAATCAATGCCCACTGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-956s21c1
Sequence:GTACCGGGATCTTCTCTATGATTGATACCTCGAGGTATCAATCATAGAGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-2635s1c1
Sequence:CCGGCCTGTGCATTTGAATTGTATACTCGAGTATACAATTCAAATGCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-477s1c1
Sequence:CCGGCAGGAGAGGTTTCGTAGCTTACTCGAGTAAGCTACGAAACCTCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-735s1c1
Sequence:CCGGGCTGCCAATGGGACAAACATACTCGAGTATGTTTGTCCCATTGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-313s1c1
Sequence:CCGGCCAGTGTACTTTACCAATATACTCGAGTATATTGGTAAAGTACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-865s1c1
Sequence:CCGGCGGATCAGTTAAGTGAAGAAACTCGAGTTTCTTCACTTAACTGATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004580
VALIDATED
RAB27A MISSION shRNA shRNA Plasmid DNA
RAB27A, member RAS oncogene family
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-313s21c1
Sequence:CCGGCCAGTGTACTTTACCAATATACTCGAGTATATTGGTAAAGTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004580.3-865s21c1
Sequence:CCGGCGGATCAGTTAAGTGAAGAAACTCGAGTTTCTTCACTTAACTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004580.3-735s21c1
Sequence:CCGGGCTGCCAATGGGACAAACATACTCGAGTATGTTTGTCCCATTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-477s21c1
Sequence:CCGGCAGGAGAGGTTTCGTAGCTTACTCGAGTAAGCTACGAAACCTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-831s21c1
Sequence:GTACCGGGAAGGAGTGGTGCGATCAAATCTCGAGATTTGATCGCACCACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-362s21c1
Sequence:GTACCGGCACAACAGTGGGCATTGATTTCTCGAGAAATCAATGCCCACTGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-956s21c1
Sequence:GTACCGGGATCTTCTCTATGATTGATACCTCGAGGTATCAATCATAGAGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-2635s1c1
Sequence:CCGGCCTGTGCATTTGAATTGTATACTCGAGTATACAATTCAAATGCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-477s1c1
Sequence:CCGGCAGGAGAGGTTTCGTAGCTTACTCGAGTAAGCTACGAAACCTCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-735s1c1
Sequence:CCGGGCTGCCAATGGGACAAACATACTCGAGTATGTTTGTCCCATTGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-313s1c1
Sequence:CCGGCCAGTGTACTTTACCAATATACTCGAGTATATTGGTAAAGTACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-865s1c1
Sequence:CCGGCGGATCAGTTAAGTGAAGAAACTCGAGTTTCTTCACTTAACTGATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004580
VALIDATED
RAB27A MISSION shRNA Lentiviral Transduction Particles
RAB27A, member RAS oncogene family
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-313s21c1
Sequence:CCGGCCAGTGTACTTTACCAATATACTCGAGTATATTGGTAAAGTACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004580.3-865s21c1
Sequence:CCGGCGGATCAGTTAAGTGAAGAAACTCGAGTTTCTTCACTTAACTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004580.3-735s21c1
Sequence:CCGGGCTGCCAATGGGACAAACATACTCGAGTATGTTTGTCCCATTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-477s21c1
Sequence:CCGGCAGGAGAGGTTTCGTAGCTTACTCGAGTAAGCTACGAAACCTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-831s21c1
Sequence:GTACCGGGAAGGAGTGGTGCGATCAAATCTCGAGATTTGATCGCACCACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-362s21c1
Sequence:GTACCGGCACAACAGTGGGCATTGATTTCTCGAGAAATCAATGCCCACTGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004580.3-956s21c1
Sequence:GTACCGGGATCTTCTCTATGATTGATACCTCGAGGTATCAATCATAGAGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-2635s1c1
Sequence:CCGGCCTGTGCATTTGAATTGTATACTCGAGTATACAATTCAAATGCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-477s1c1
Sequence:CCGGCAGGAGAGGTTTCGTAGCTTACTCGAGTAAGCTACGAAACCTCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-735s1c1
Sequence:CCGGGCTGCCAATGGGACAAACATACTCGAGTATGTTTGTCCCATTGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-313s1c1
Sequence:CCGGCCAGTGTACTTTACCAATATACTCGAGTATATTGGTAAAGTACACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004580.3-865s1c1
Sequence:CCGGCGGATCAGTTAAGTGAAGAAACTCGAGTTTCTTCACTTAACTGATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)