EMAIL THIS PAGE TO A FRIEND

RAB27B

RAB27B, member RAS oncogene family

95 Gene Product Result for
Synonyms: C25KG
UniProtKB ID: O00194, B2RAB0, Q9BZB6
Gene ID:
Human(5874) Summary: Members of the Rab protein family, including RAB27B, are prenylated, membrane-bound proteins involved in vesicular fusion and trafficking (Chen et al., 1997 [PubMed 9066979]
Mouse(80718) RAB27b, member RAS oncogene family
Rat(84590) RAB27B, member RAS oncogene family
domestic guinea pig(100732593) RAB27B, member RAS oncogene family
naked mole-rat(101705828) RAB27B, member RAS oncogene family
cow(282858) RAB27B, member RAS oncogene family
sheep(101120036) RAB27B, member RAS oncogene family
dog(483974) RAB27B, member RAS oncogene family
domestic cat(101096852) RAB27B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0238 AQUA Peptide VHLQLWDTAGQE[R] African clawed frog, cow, dog, honey bee, human, mouse, rat pricing
AQ0239 AQUA Peptide YGIPYFETSAATGQNVE[K] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004163 Rosetta Predictions human pricing
NM_053459 Rosetta Predictions rat pricing
NM_001082553 Rosetta Predictions mouse pricing
NM_030554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027606 predicted 560
2 SASI_Hs01_00027607 predicted 409
3 SASI_Hs01_00027608 predicted 230
4 SASI_Hs01_00027609 predicted 830
5 SASI_Hs01_00027610 predicted 514
6 SASI_Hs01_00027611 predicted 417
7 SASI_Hs01_00027612 predicted 824
8 SASI_Hs01_00027613 predicted 636
9 SASI_Hs02_00337027 predicted 440
10 SASI_Hs01_00027614 predicted 682
11 SASI_Hs01_00027615 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104908 predicted 313
2 SASI_Rn01_00104909 predicted 305
3 SASI_Rn01_00104910 predicted 232
4 SASI_Rn01_00104911 predicted 394
5 SASI_Rn01_00104913 predicted 476
6 SASI_Rn02_00266038 predicted 422
7 SASI_Rn02_00266039 predicted 291
8 SASI_Rn01_00104915 predicted 277
9 SASI_Rn01_00104916 predicted 572
10 SASI_Rn02_00266040 predicted 277
11 SASI_Rn01_00104912 predicted 298
12 SASI_Rn01_00104914 predicted 509
13 SASI_Rn01_00104917 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299365 predicted 1202
2 SASI_Mm02_00299366 predicted 1150
3 SASI_Mm02_00299367 predicted 1028
4 SASI_Mm02_00299368 predicted 1313
5 SASI_Mm02_00299369 predicted 1046
6 SASI_Mm02_00299370 predicted 1014
7 SASI_Mm02_00299371 predicted 532
8 SASI_Mm02_00299372 predicted 888
9 SASI_Mm02_00299373 predicted 1195
10 SASI_Mm02_00299374 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336755 predicted 1308
2 SASI_Mm02_00336756 predicted 1254
3 SASI_Mm02_00336757 predicted 1121
4 SASI_Mm02_00336758 predicted 1411
5 SASI_Mm02_00336759 predicted 1143
6 SASI_Mm02_00336760 predicted 1115
7 SASI_Mm01_00023231 predicted 633
8 SASI_Mm01_00023232 predicted 989
9 SASI_Mm02_00336761 predicted 1299
10 SASI_Mm01_00023234 predicted 598
11 SASI_Mm01_00023227 predicted 948
12 SASI_Mm01_00023228 predicted 680
13 SASI_Mm01_00023229 predicted 854
14 SASI_Mm01_00023230 predicted 731
15 SASI_Mm01_00023233 predicted 910
16 SASI_Mm01_00023235 predicted 978
17 SASI_Mm01_00023236 predicted 1413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030554
VALIDATED
RAB27B MISSION shRNA Bacterial Glycerol Stock
RAB27B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-532s21c1
Sequence:GTACCGGGAGATGCCATGGGCTTCTTACCTCGAGGTAAGAAGCCCATGGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030554.3-966s21c1
Sequence:CCGGCCTGAGACAATGTCAAACCATCTCGAGATGGTTTGACATTGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-791s21c1
Sequence:CCGGGCTTCTGGACTTAATCATGAACTCGAGTTCATGATTAAGTCCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-637s21c1
Sequence:GTACCGGACCCAGACATAGTATTAATTGCTCGAGCAATTAATACTATGTCTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-603s21c1
Sequence:GTACCGGATGAGTCAACTGCAGGCAAATCTCGAGATTTGCCTGCAGTTGACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-725s1c1
Sequence:CCGGCGGGAAGACAACATTTCTCTACTCGAGTAGAGAAATGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-730s21c1
Sequence:CCGGGCATACCATACTTCGAAACAACTCGAGTTGTTTCGAAGTATGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1368s1c1
Sequence:CCGGCCTGAGACAATGTCAAACCATCTCGAGATGGTTTGACATTGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1193s1c1
Sequence:CCGGGCTTCTGGACTTAATCATGAACTCGAGTTCATGATTAAGTCCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-741s1c1
Sequence:CCGGCTCTATAGATACACAGACAATCTCGAGATTGTCTGTGTATCTATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1132s1c1
Sequence:CCGGGCATACCATACTTCGAAACAACTCGAGTTGTTTCGAAGTATGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-323s21c1
Sequence:CCGGCGGGAAGACAACATTTCTCTACTCGAGTAGAGAAATGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030554
VALIDATED
RAB27B MISSION shRNA shRNA Plasmid DNA
RAB27B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-532s21c1
Sequence:GTACCGGGAGATGCCATGGGCTTCTTACCTCGAGGTAAGAAGCCCATGGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030554.3-966s21c1
Sequence:CCGGCCTGAGACAATGTCAAACCATCTCGAGATGGTTTGACATTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-791s21c1
Sequence:CCGGGCTTCTGGACTTAATCATGAACTCGAGTTCATGATTAAGTCCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-637s21c1
Sequence:GTACCGGACCCAGACATAGTATTAATTGCTCGAGCAATTAATACTATGTCTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-603s21c1
Sequence:GTACCGGATGAGTCAACTGCAGGCAAATCTCGAGATTTGCCTGCAGTTGACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-725s1c1
Sequence:CCGGCGGGAAGACAACATTTCTCTACTCGAGTAGAGAAATGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-730s21c1
Sequence:CCGGGCATACCATACTTCGAAACAACTCGAGTTGTTTCGAAGTATGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1368s1c1
Sequence:CCGGCCTGAGACAATGTCAAACCATCTCGAGATGGTTTGACATTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1193s1c1
Sequence:CCGGGCTTCTGGACTTAATCATGAACTCGAGTTCATGATTAAGTCCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-741s1c1
Sequence:CCGGCTCTATAGATACACAGACAATCTCGAGATTGTCTGTGTATCTATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1132s1c1
Sequence:CCGGGCATACCATACTTCGAAACAACTCGAGTTGTTTCGAAGTATGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-323s21c1
Sequence:CCGGCGGGAAGACAACATTTCTCTACTCGAGTAGAGAAATGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030554
VALIDATED
RAB27B MISSION shRNA Lentiviral Transduction Particles
RAB27B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-532s21c1
Sequence:GTACCGGGAGATGCCATGGGCTTCTTACCTCGAGGTAAGAAGCCCATGGCATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030554.3-966s21c1
Sequence:CCGGCCTGAGACAATGTCAAACCATCTCGAGATGGTTTGACATTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-791s21c1
Sequence:CCGGGCTTCTGGACTTAATCATGAACTCGAGTTCATGATTAAGTCCAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-637s21c1
Sequence:GTACCGGACCCAGACATAGTATTAATTGCTCGAGCAATTAATACTATGTCTGGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-603s21c1
Sequence:GTACCGGATGAGTCAACTGCAGGCAAATCTCGAGATTTGCCTGCAGTTGACTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-725s1c1
Sequence:CCGGCGGGAAGACAACATTTCTCTACTCGAGTAGAGAAATGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-730s21c1
Sequence:CCGGGCATACCATACTTCGAAACAACTCGAGTTGTTTCGAAGTATGGTATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1368s1c1
Sequence:CCGGCCTGAGACAATGTCAAACCATCTCGAGATGGTTTGACATTGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1193s1c1
Sequence:CCGGGCTTCTGGACTTAATCATGAACTCGAGTTCATGATTAAGTCCAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-741s1c1
Sequence:CCGGCTCTATAGATACACAGACAATCTCGAGATTGTCTGTGTATCTATAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030554.2-1132s1c1
Sequence:CCGGGCATACCATACTTCGAAACAACTCGAGTTGTTTCGAAGTATGGTATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030554.3-323s21c1
Sequence:CCGGCGGGAAGACAACATTTCTCTACTCGAGTAGAGAAATGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004163
VALIDATED
RAB27B MISSION shRNA Bacterial Glycerol Stock
RAB27B, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-382s21c1
Sequence:CCGGGACGCCATGGGCTTCTTATTACTCGAGTAATAAGAAGCCCATGGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-416s21c1
Sequence:CCGGCCAGTCAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-995s21c1
Sequence:CCGGCATCATCATGGATACTCAATTCTCGAGAATTGAGTATCCATGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004163.3-835s21c1
Sequence:GTACCGGACACAATTGTTGTTGAGTAAACTCGAGTTTACTCAACAACAATTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004163.3-524s21c1
Sequence:GTACCGGCAGATCAGAGGGAAGTCAATGCTCGAGCATTGACTTCCCTCTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-455s21c1
Sequence:CCGGGCCAACTGCAAGCAAATGCTTCTCGAGAAGCATTTGCTTGCAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004163.3-555s21c1
Sequence:GTACCGGTCGGGAACTGGCTGACAAATACTCGAGTATTTGTCAGCCAGTTCCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-697s21c1
Sequence:CCGGGATACTGTCAATGGTGGAAATCTCGAGATTTCCACCATTGACAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-217s1c1
Sequence:CCGGCCCAAATTCATCACTACAGTACTCGAGTACTGTAGTGATGAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-566s1c1
Sequence:CCGGCTGACAAATATGGCATACCATCTCGAGATGGTATGCCATATTTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004163.3-455s1c1
Sequence:CCGGGCCAACTGCAAGCAAATGCTTCTCGAGAAGCATTTGCTTGCAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-235s1c1
Sequence:CCGGGTAGGAATAGACTTTCGGGAACTCGAGTTCCCGAAAGTCTATTCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004163.3-697s1c1
Sequence:CCGGGATACTGTCAATGGTGGAAATCTCGAGATTTCCACCATTGACAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004163
VALIDATED
RAB27B MISSION shRNA shRNA Plasmid DNA
RAB27B, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-382s21c1
Sequence:CCGGGACGCCATGGGCTTCTTATTACTCGAGTAATAAGAAGCCCATGGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-416s21c1
Sequence:CCGGCCAGTCAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-995s21c1
Sequence:CCGGCATCATCATGGATACTCAATTCTCGAGAATTGAGTATCCATGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004163.3-835s21c1
Sequence:GTACCGGACACAATTGTTGTTGAGTAAACTCGAGTTTACTCAACAACAATTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004163.3-524s21c1
Sequence:GTACCGGCAGATCAGAGGGAAGTCAATGCTCGAGCATTGACTTCCCTCTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-455s21c1
Sequence:CCGGGCCAACTGCAAGCAAATGCTTCTCGAGAAGCATTTGCTTGCAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004163.3-555s21c1
Sequence:GTACCGGTCGGGAACTGGCTGACAAATACTCGAGTATTTGTCAGCCAGTTCCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-697s21c1
Sequence:CCGGGATACTGTCAATGGTGGAAATCTCGAGATTTCCACCATTGACAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-217s1c1
Sequence:CCGGCCCAAATTCATCACTACAGTACTCGAGTACTGTAGTGATGAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-566s1c1
Sequence:CCGGCTGACAAATATGGCATACCATCTCGAGATGGTATGCCATATTTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004163.3-455s1c1
Sequence:CCGGGCCAACTGCAAGCAAATGCTTCTCGAGAAGCATTTGCTTGCAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-235s1c1
Sequence:CCGGGTAGGAATAGACTTTCGGGAACTCGAGTTCCCGAAAGTCTATTCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004163.3-697s1c1
Sequence:CCGGGATACTGTCAATGGTGGAAATCTCGAGATTTCCACCATTGACAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004163
VALIDATED
RAB27B MISSION shRNA Lentiviral Transduction Particles
RAB27B, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-382s21c1
Sequence:CCGGGACGCCATGGGCTTCTTATTACTCGAGTAATAAGAAGCCCATGGCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-416s21c1
Sequence:CCGGCCAGTCAACAGAGCTTCTTAACTCGAGTTAAGAAGCTCTGTTGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-995s21c1
Sequence:CCGGCATCATCATGGATACTCAATTCTCGAGAATTGAGTATCCATGATGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004163.3-835s21c1
Sequence:GTACCGGACACAATTGTTGTTGAGTAAACTCGAGTTTACTCAACAACAATTGTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004163.3-524s21c1
Sequence:GTACCGGCAGATCAGAGGGAAGTCAATGCTCGAGCATTGACTTCCCTCTGATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-455s21c1
Sequence:CCGGGCCAACTGCAAGCAAATGCTTCTCGAGAAGCATTTGCTTGCAGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004163.3-555s21c1
Sequence:GTACCGGTCGGGAACTGGCTGACAAATACTCGAGTATTTGTCAGCCAGTTCCCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004163.3-697s21c1
Sequence:CCGGGATACTGTCAATGGTGGAAATCTCGAGATTTCCACCATTGACAGTATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-217s1c1
Sequence:CCGGCCCAAATTCATCACTACAGTACTCGAGTACTGTAGTGATGAATTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-566s1c1
Sequence:CCGGCTGACAAATATGGCATACCATCTCGAGATGGTATGCCATATTTGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004163.3-455s1c1
Sequence:CCGGGCCAACTGCAAGCAAATGCTTCTCGAGAAGCATTTGCTTGCAGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004163.3-235s1c1
Sequence:CCGGGTAGGAATAGACTTTCGGGAACTCGAGTTCCCGAAAGTCTATTCCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004163.3-697s1c1
Sequence:CCGGGATACTGTCAATGGTGGAAATCTCGAGATTTCCACCATTGACAGTATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)