EMAIL THIS PAGE TO A FRIEND

RAB28

RAB28, member RAS oncogene family

125 Gene Product Result for
Synonyms: CORD18
UniProtKB ID: P51157, G8JLC5, Q8IYR8, Q8NI05
Gene ID:
Human(9364) Summary: This gene encodes a member of the Rab subfamily of Ras-related small GTPases. The encoded protein may be involved in regulating intracellular trafficking. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 9 and X. [provided by RefSeq, Apr 2009]
Mouse(100972) RAB28, member RAS oncogene family
Rat(117049) RAB28, member RAS oncogene family
Thale Cress(839571) responsive to abscisic acid 28
Zebrafish(326923) RAB28, member RAS oncogene family
chicken(422839) RAB28, member RAS oncogene family
dog(477884) RAB28, member RAS oncogene family
domestic cat(101090355) RAB28, member RAS oncogene family
cow(536021) RAB28, member RAS oncogene family
sheep(100147792) RAB28, member RAS oncogene family
naked mole-rat(101726380) RAB28, member RAS oncogene family
domestic guinea pig(100729430) RAB28, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004249 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017979 Rosetta Predictions human pricing
NM_004249 Rosetta Predictions human pricing
NM_053978 Rosetta Predictions rat pricing
NM_027295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235006 predicted 475
2 SASI_Hs01_00235007 predicted 443
3 SASI_Hs01_00235008 predicted 445
4 SASI_Hs01_00235009 predicted 512
5 SASI_Hs01_00235011 predicted 494
6 SASI_Hs01_00235012 predicted 438
7 SASI_Hs01_00235013 predicted 485
8 SASI_Hs01_00235014 predicted 504
9 SASI_Hs01_00235015 predicted 495
10 SASI_Hs02_00306868 predicted 495
11 SASI_Hs01_00235010 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157221 predicted 292
2 SASI_Hs01_00157222 predicted 258
3 SASI_Hs01_00157223 predicted 259
4 SASI_Hs01_00157224 predicted 328
5 SASI_Hs01_00157226 predicted 309
6 SASI_Hs01_00157227 predicted 263
7 SASI_Hs01_00157228 predicted 301
8 SASI_Hs01_00157229 predicted 324
9 SASI_Hs01_00157230 predicted 310
10 SASI_Hs02_00337191 predicted 315
11 SASI_Hs01_00157225 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108406 predicted 600
2 SASI_Rn01_00108407 predicted 928
3 SASI_Rn01_00108408 predicted 539
4 SASI_Rn01_00108409 predicted 629
5 SASI_Rn01_00108410 predicted 412
6 SASI_Rn02_00266965 predicted 303
7 SASI_Rn01_00108412 predicted 322
8 SASI_Rn01_00108413 predicted 282
9 SASI_Rn01_00108414 predicted 234
10 SASI_Rn01_00108415 predicted 238
11 SASI_Rn01_00108411 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143534 predicted 758
2 SASI_Mm02_00331900 predicted 331
3 SASI_Mm01_00143539 predicted 303
4 SASI_Mm01_00143540 predicted 334
5 SASI_Mm02_00331901 predicted 537
6 SASI_Mm01_00143541 predicted 458
7 SASI_Mm01_00143542 predicted 474
8 SASI_Mm01_00143543 predicted 386
9 SASI_Mm02_00331902 predicted 486
10 SASI_Mm02_00331903 predicted 589
11 SASI_Mm01_00143535 predicted 697
12 SASI_Mm01_00143536 predicted 581
13 SASI_Mm01_00143537 predicted 381
14 SASI_Mm01_00143538 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004249
VALIDATED
RAB28 MISSION shRNA Bacterial Glycerol Stock
RAB28, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004249.1-589s1c1
Sequence:CCGGGAAATAGTGAAGTACCCGGAACTCGAGTTCCGGGTACTTCACTATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-177s1c1
Sequence:CCGGCTTGAATGTTACCCTTCAAATCTCGAGATTTGAAGGGTAACATTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004249.1-370s1c1
Sequence:CCGGGTTGCCTTGGTAGGCAATAAACTCGAGTTTATTGCCTACCAAGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-75s1c1
Sequence:CCGGGACCTCCTTAACTACGTGTTTCTCGAGAAACACGTAGTTAAGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-265s1c1
Sequence:CCGGGTCCTCTTGGTATATGATATTCTCGAGAATATCATATACCAAGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-775s21c1
Sequence:GTACCGGTAGAACAGTCACAGCGTATTGCTCGAGCAATACGCTGTGACTGTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1342s21c1
Sequence:GTACCGGCAGCAATTTCATTCTCTTATCCTCGAGGATAAGAGAATGAAATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1366s21c1
Sequence:GTACCGGACTTGTATGTGTCAAAGTATACTCGAGTATACTTTGACACATACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1093s21c1
Sequence:GTACCGGTCCCAACTTGCTTCATCATTGCTCGAGCAATGATGAAGCAAGTTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-874s21c1
Sequence:GTACCGGAGTAGTGCAGAGGGTGGTGAACTCGAGTTCACCACCCTCTGCACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-521s21c1
Sequence:GTACCGGGAATTTAGAAGATTGGTATACCTCGAGGTATACCAATCTTCTAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-964s21c1
Sequence:GTACCGGTGCAGTTCAGTGAGCGCATTTCTCGAGAAATGCGCTCACTGAACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-807s21c1
Sequence:GTACCGGATAGTGAAGTACCCGGAAGAACTCGAGTTCTTCCGGGTACTTCACTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004249
VALIDATED
RAB28 MISSION shRNA shRNA Plasmid DNA
RAB28, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004249.1-589s1c1
Sequence:CCGGGAAATAGTGAAGTACCCGGAACTCGAGTTCCGGGTACTTCACTATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-177s1c1
Sequence:CCGGCTTGAATGTTACCCTTCAAATCTCGAGATTTGAAGGGTAACATTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004249.1-370s1c1
Sequence:CCGGGTTGCCTTGGTAGGCAATAAACTCGAGTTTATTGCCTACCAAGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-75s1c1
Sequence:CCGGGACCTCCTTAACTACGTGTTTCTCGAGAAACACGTAGTTAAGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-265s1c1
Sequence:CCGGGTCCTCTTGGTATATGATATTCTCGAGAATATCATATACCAAGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-775s21c1
Sequence:GTACCGGTAGAACAGTCACAGCGTATTGCTCGAGCAATACGCTGTGACTGTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1342s21c1
Sequence:GTACCGGCAGCAATTTCATTCTCTTATCCTCGAGGATAAGAGAATGAAATTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1366s21c1
Sequence:GTACCGGACTTGTATGTGTCAAAGTATACTCGAGTATACTTTGACACATACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1093s21c1
Sequence:GTACCGGTCCCAACTTGCTTCATCATTGCTCGAGCAATGATGAAGCAAGTTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-874s21c1
Sequence:GTACCGGAGTAGTGCAGAGGGTGGTGAACTCGAGTTCACCACCCTCTGCACTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-521s21c1
Sequence:GTACCGGGAATTTAGAAGATTGGTATACCTCGAGGTATACCAATCTTCTAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-964s21c1
Sequence:GTACCGGTGCAGTTCAGTGAGCGCATTTCTCGAGAAATGCGCTCACTGAACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-807s21c1
Sequence:GTACCGGATAGTGAAGTACCCGGAAGAACTCGAGTTCTTCCGGGTACTTCACTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004249
VALIDATED
RAB28 MISSION shRNA Lentiviral Transduction Particles
RAB28, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004249.1-589s1c1
Sequence:CCGGGAAATAGTGAAGTACCCGGAACTCGAGTTCCGGGTACTTCACTATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-177s1c1
Sequence:CCGGCTTGAATGTTACCCTTCAAATCTCGAGATTTGAAGGGTAACATTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004249.1-370s1c1
Sequence:CCGGGTTGCCTTGGTAGGCAATAAACTCGAGTTTATTGCCTACCAAGGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-75s1c1
Sequence:CCGGGACCTCCTTAACTACGTGTTTCTCGAGAAACACGTAGTTAAGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004249.1-265s1c1
Sequence:CCGGGTCCTCTTGGTATATGATATTCTCGAGAATATCATATACCAAGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-775s21c1
Sequence:GTACCGGTAGAACAGTCACAGCGTATTGCTCGAGCAATACGCTGTGACTGTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1342s21c1
Sequence:GTACCGGCAGCAATTTCATTCTCTTATCCTCGAGGATAAGAGAATGAAATTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1366s21c1
Sequence:GTACCGGACTTGTATGTGTCAAAGTATACTCGAGTATACTTTGACACATACAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-1093s21c1
Sequence:GTACCGGTCCCAACTTGCTTCATCATTGCTCGAGCAATGATGAAGCAAGTTGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-874s21c1
Sequence:GTACCGGAGTAGTGCAGAGGGTGGTGAACTCGAGTTCACCACCCTCTGCACTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-521s21c1
Sequence:GTACCGGGAATTTAGAAGATTGGTATACCTCGAGGTATACCAATCTTCTAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004249.3-964s21c1
Sequence:GTACCGGTGCAGTTCAGTGAGCGCATTTCTCGAGAAATGCGCTCACTGAACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004249.3-807s21c1
Sequence:GTACCGGATAGTGAAGTACCCGGAAGAACTCGAGTTCTTCCGGGTACTTCACTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027295
VALIDATED
RAB28 MISSION shRNA Bacterial Glycerol Stock
RAB28, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-707s21c1
Sequence:CCGGCCTGGGAATCAAATTAAACAACTCGAGTTGTTTAATTTGATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-597s21c1
Sequence:CCGGGCTGATAAGCACTTACGATTTCTCGAGAAATCGTAAGTGCTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-302s1c1
Sequence:CCGGGCAGACGATAGGACTGGATTTCTCGAGAAATCCAGTCCTATCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027295.1-1309s1c1
Sequence:CCGGGCTTCAAATGAGGCTGTAATACTCGAGTATTACAGCCTCATTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-707s1c1
Sequence:CCGGCCTGGGAATCAAATTAAACAACTCGAGTTGTTTAATTTGATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-843s1c1
Sequence:CCGGGCACACACTGTATTGATAGTTCTCGAGAACTATCAATACAGTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-597s1c1
Sequence:CCGGGCTGATAAGCACTTACGATTTCTCGAGAAATCGTAAGTGCTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-302s21c1
Sequence:CCGGGCAGACGATAGGACTGGATTTCTCGAGAAATCCAGTCCTATCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027295.2-843s21c1
Sequence:CCGGGCACACACTGTATTGATAGTTCTCGAGAACTATCAATACAGTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027295.2-1309s21c1
Sequence:CCGGGCTTCAAATGAGGCTGTAATACTCGAGTATTACAGCCTCATTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027295
VALIDATED
RAB28 MISSION shRNA shRNA Plasmid DNA
RAB28, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-707s21c1
Sequence:CCGGCCTGGGAATCAAATTAAACAACTCGAGTTGTTTAATTTGATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-597s21c1
Sequence:CCGGGCTGATAAGCACTTACGATTTCTCGAGAAATCGTAAGTGCTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-302s1c1
Sequence:CCGGGCAGACGATAGGACTGGATTTCTCGAGAAATCCAGTCCTATCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027295.1-1309s1c1
Sequence:CCGGGCTTCAAATGAGGCTGTAATACTCGAGTATTACAGCCTCATTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-707s1c1
Sequence:CCGGCCTGGGAATCAAATTAAACAACTCGAGTTGTTTAATTTGATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-843s1c1
Sequence:CCGGGCACACACTGTATTGATAGTTCTCGAGAACTATCAATACAGTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-597s1c1
Sequence:CCGGGCTGATAAGCACTTACGATTTCTCGAGAAATCGTAAGTGCTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-302s21c1
Sequence:CCGGGCAGACGATAGGACTGGATTTCTCGAGAAATCCAGTCCTATCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027295.2-843s21c1
Sequence:CCGGGCACACACTGTATTGATAGTTCTCGAGAACTATCAATACAGTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027295.2-1309s21c1
Sequence:CCGGGCTTCAAATGAGGCTGTAATACTCGAGTATTACAGCCTCATTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027295
VALIDATED
RAB28 MISSION shRNA Lentiviral Transduction Particles
RAB28, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-707s21c1
Sequence:CCGGCCTGGGAATCAAATTAAACAACTCGAGTTGTTTAATTTGATTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-597s21c1
Sequence:CCGGGCTGATAAGCACTTACGATTTCTCGAGAAATCGTAAGTGCTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-302s1c1
Sequence:CCGGGCAGACGATAGGACTGGATTTCTCGAGAAATCCAGTCCTATCGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027295.1-1309s1c1
Sequence:CCGGGCTTCAAATGAGGCTGTAATACTCGAGTATTACAGCCTCATTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-707s1c1
Sequence:CCGGCCTGGGAATCAAATTAAACAACTCGAGTTGTTTAATTTGATTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-843s1c1
Sequence:CCGGGCACACACTGTATTGATAGTTCTCGAGAACTATCAATACAGTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027295.1-597s1c1
Sequence:CCGGGCTGATAAGCACTTACGATTTCTCGAGAAATCGTAAGTGCTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027295.2-302s21c1
Sequence:CCGGGCAGACGATAGGACTGGATTTCTCGAGAAATCCAGTCCTATCGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027295.2-843s21c1
Sequence:CCGGGCACACACTGTATTGATAGTTCTCGAGAACTATCAATACAGTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027295.2-1309s21c1
Sequence:CCGGGCTTCAAATGAGGCTGTAATACTCGAGTATTACAGCCTCATTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)