EMAIL THIS PAGE TO A FRIEND

RAB2B

RAB2B, member RAS oncogene family

95 Gene Product Result for
UniProtKB ID: Q8WUD1, B2RD03, D3DS24
Gene ID:
Human(84932) Summary: Members of the Rab protein family are nontransforming monomeric GTP-binding proteins of the Ras superfamily that contain 4 highly conserved regions involved in GTP binding and hydrolysis. Rab proteins are prenylated, membrane-bound proteins involved in vesicular fusion and trafficking; see MIM 179508.[supplied by OMIM, Apr 2006]
Mouse(76338) RAB2B, member RAS oncogene family
Rat(305853) RAB2B, member RAS oncogene family
dog(475402) RAB2B, member RAS oncogene family
domestic cat(101097649) RAB2B, member RAS oncogene family
cow(528574) RAB2B, member RAS oncogene family
sheep(101108752) RAB2B, member RAS oncogene family
naked mole-rat(101699671) RAB2B, member RAS oncogene family
domestic guinea pig(100713123) RAB2B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0267 AQUA Peptide LQIWDTAGQESF[R] African clawed frog, chicken, cow, dog, human, mouse, rat, soybean, wheat pricing
AQ0266 AQUA Peptide GAAGALLVYDIT[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat, soybean, wheat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032846 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032846 Rosetta Predictions human pricing
NM_001037645 Rosetta Predictions rat pricing
NM_172601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119507 predicted 565
2 SASI_Hs01_00119508 predicted 412
3 SASI_Hs01_00119509 predicted 290
4 SASI_Hs01_00119510 predicted 596
5 SASI_Hs01_00119511 predicted 412
6 SASI_Hs01_00119512 predicted 421
7 SASI_Hs01_00119513 predicted 606
8 SASI_Hs01_00119514 predicted 214
9 SASI_Hs01_00119516 predicted 627
10 SASI_Hs02_00360441 predicted 486
11 SASI_Hs01_00119515 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071398 predicted 570
2 SASI_Rn01_00071399 predicted 448
3 SASI_Rn02_00204517 predicted 914
4 SASI_Rn01_00071400 predicted 602
5 SASI_Rn01_00071401 predicted 431
6 SASI_Rn01_00071402 predicted 848
7 SASI_Rn01_00071403 predicted 424
8 SASI_Rn01_00071404 predicted 786
9 SASI_Rn01_00071405 predicted 257
10 SASI_Rn01_00071407 predicted 366
11 SASI_Rn01_00071406 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058665 predicted 917
2 SASI_Mm01_00058666 predicted 803
3 SASI_Mm01_00058667 predicted 587
4 SASI_Mm01_00058668 predicted 276
5 SASI_Mm01_00058669 predicted 547
6 SASI_Mm01_00058670 predicted 555
7 SASI_Mm01_00058671 predicted 534
8 SASI_Mm01_00058672 predicted 412
9 SASI_Mm01_00058673 predicted 801
10 SASI_Mm01_00058674 predicted 897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172601
VALIDATED
RAB2B MISSION shRNA Bacterial Glycerol Stock
RAB2B, member RAS oncogene family
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-597s21c1
Sequence:CCGGAGATCCAGCAAGGTTTATTTGCTCGAGCAAATAAACCTTGCTGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-427s21c1
Sequence:CCGGTATAATGCTGATCGGGAATAACTCGAGTTATTCCCGATCAGCATTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-658s21c1
Sequence:CCGGGCAGTCAATTACCTCCTCAGTCTCGAGACTGAGGAGGTAATTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-552s21c1
Sequence:CCGGATGTTGAAGAGGCCTACATTACTCGAGTAATGTAGGCCTCTTCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-154s21c1
Sequence:CCGGCCTCCTTCAGTTTACCGACAACTCGAGTTGTCGGTAAACTGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-935s21c1
Sequence:CCGGCCGCGTAGATTATGGCTCTTTCTCGAGAAAGAGCCATAATCTACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-936s1c1
Sequence:CCGGCCGCGTAGATTATGGCTCTTTCTCGAGAAAGAGCCATAATCTACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172601.1-511s1c1
Sequence:CCGGACGGCCTTATATTCATGGAAACTCGAGTTTCCATGAATATAAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172601.1-608s1c1
Sequence:CCGGAGGTTTATTTGATGTCCACAACTCGAGTTGTGGACATCAAATAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-659s1c1
Sequence:CCGGGCAGTCAATTACCTCCTCAGTCTCGAGACTGAGGAGGTAATTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-155s1c1
Sequence:CCGGCCTCCTTCAGTTTACCGACAACTCGAGTTGTCGGTAAACTGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172601
VALIDATED
RAB2B MISSION shRNA shRNA Plasmid DNA
RAB2B, member RAS oncogene family
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-597s21c1
Sequence:CCGGAGATCCAGCAAGGTTTATTTGCTCGAGCAAATAAACCTTGCTGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-427s21c1
Sequence:CCGGTATAATGCTGATCGGGAATAACTCGAGTTATTCCCGATCAGCATTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-658s21c1
Sequence:CCGGGCAGTCAATTACCTCCTCAGTCTCGAGACTGAGGAGGTAATTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-552s21c1
Sequence:CCGGATGTTGAAGAGGCCTACATTACTCGAGTAATGTAGGCCTCTTCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-154s21c1
Sequence:CCGGCCTCCTTCAGTTTACCGACAACTCGAGTTGTCGGTAAACTGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-935s21c1
Sequence:CCGGCCGCGTAGATTATGGCTCTTTCTCGAGAAAGAGCCATAATCTACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-936s1c1
Sequence:CCGGCCGCGTAGATTATGGCTCTTTCTCGAGAAAGAGCCATAATCTACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172601.1-511s1c1
Sequence:CCGGACGGCCTTATATTCATGGAAACTCGAGTTTCCATGAATATAAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172601.1-608s1c1
Sequence:CCGGAGGTTTATTTGATGTCCACAACTCGAGTTGTGGACATCAAATAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-659s1c1
Sequence:CCGGGCAGTCAATTACCTCCTCAGTCTCGAGACTGAGGAGGTAATTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-155s1c1
Sequence:CCGGCCTCCTTCAGTTTACCGACAACTCGAGTTGTCGGTAAACTGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172601
VALIDATED
RAB2B MISSION shRNA Lentiviral Transduction Particles
RAB2B, member RAS oncogene family
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-597s21c1
Sequence:CCGGAGATCCAGCAAGGTTTATTTGCTCGAGCAAATAAACCTTGCTGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-427s21c1
Sequence:CCGGTATAATGCTGATCGGGAATAACTCGAGTTATTCCCGATCAGCATTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-658s21c1
Sequence:CCGGGCAGTCAATTACCTCCTCAGTCTCGAGACTGAGGAGGTAATTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172601.2-552s21c1
Sequence:CCGGATGTTGAAGAGGCCTACATTACTCGAGTAATGTAGGCCTCTTCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-154s21c1
Sequence:CCGGCCTCCTTCAGTTTACCGACAACTCGAGTTGTCGGTAAACTGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172601.2-935s21c1
Sequence:CCGGCCGCGTAGATTATGGCTCTTTCTCGAGAAAGAGCCATAATCTACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-936s1c1
Sequence:CCGGCCGCGTAGATTATGGCTCTTTCTCGAGAAAGAGCCATAATCTACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172601.1-511s1c1
Sequence:CCGGACGGCCTTATATTCATGGAAACTCGAGTTTCCATGAATATAAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172601.1-608s1c1
Sequence:CCGGAGGTTTATTTGATGTCCACAACTCGAGTTGTGGACATCAAATAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-659s1c1
Sequence:CCGGGCAGTCAATTACCTCCTCAGTCTCGAGACTGAGGAGGTAATTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172601.1-155s1c1
Sequence:CCGGCCTCCTTCAGTTTACCGACAACTCGAGTTGTCGGTAAACTGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032846
VALIDATED
RAB2B MISSION shRNA Bacterial Glycerol Stock
RAB2B, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-348s21c1
Sequence:CCGGCGACATTACAAGGCGTGAAACCTCGAGGTTTCACGCCTTGTAATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-1552s21c1
Sequence:CCGGGCCCTACTCTCCACTAATTATCTCGAGATAATTAGTGGAGAGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-698s21c1
Sequence:CCGGAGCGGAACTCTCGTGACATAGCTCGAGCTATGTCACGAGAGTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-504s21c1
Sequence:CCGGTAGGGAGCATGGACTTATATTCTCGAGAATATAAGTCCATGCTCCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-221s21c1
Sequence:CCGGGAGCTCGTATGGTCAACATTGCTCGAGCAATGTTGACCATACGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-502s1c1
Sequence:CCGGGCTAGGGAGCATGGACTTATACTCGAGTATAAGTCCATGCTCCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-223s1c1
Sequence:CCGGGCTCGTATGGTCAACATTGATCTCGAGATCAATGTTGACCATACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032846.2-565s1c1
Sequence:CCGGGCCTTCATTAACACAGCCAAACTCGAGTTTGGCTGTGTTAATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032846.2-198s1c1
Sequence:CCGGCCTCACAATAGGTGTGGAGTTCTCGAGAACTCCACACCTATTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-405s1c1
Sequence:CCGGGCAGCACTCTAGTTCCAACATCTCGAGATGTTGGAACTAGAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032846
VALIDATED
RAB2B MISSION shRNA shRNA Plasmid DNA
RAB2B, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-348s21c1
Sequence:CCGGCGACATTACAAGGCGTGAAACCTCGAGGTTTCACGCCTTGTAATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-1552s21c1
Sequence:CCGGGCCCTACTCTCCACTAATTATCTCGAGATAATTAGTGGAGAGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-698s21c1
Sequence:CCGGAGCGGAACTCTCGTGACATAGCTCGAGCTATGTCACGAGAGTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-504s21c1
Sequence:CCGGTAGGGAGCATGGACTTATATTCTCGAGAATATAAGTCCATGCTCCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-221s21c1
Sequence:CCGGGAGCTCGTATGGTCAACATTGCTCGAGCAATGTTGACCATACGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-502s1c1
Sequence:CCGGGCTAGGGAGCATGGACTTATACTCGAGTATAAGTCCATGCTCCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-223s1c1
Sequence:CCGGGCTCGTATGGTCAACATTGATCTCGAGATCAATGTTGACCATACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032846.2-565s1c1
Sequence:CCGGGCCTTCATTAACACAGCCAAACTCGAGTTTGGCTGTGTTAATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032846.2-198s1c1
Sequence:CCGGCCTCACAATAGGTGTGGAGTTCTCGAGAACTCCACACCTATTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-405s1c1
Sequence:CCGGGCAGCACTCTAGTTCCAACATCTCGAGATGTTGGAACTAGAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032846
VALIDATED
RAB2B MISSION shRNA Lentiviral Transduction Particles
RAB2B, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-348s21c1
Sequence:CCGGCGACATTACAAGGCGTGAAACCTCGAGGTTTCACGCCTTGTAATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-1552s21c1
Sequence:CCGGGCCCTACTCTCCACTAATTATCTCGAGATAATTAGTGGAGAGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-698s21c1
Sequence:CCGGAGCGGAACTCTCGTGACATAGCTCGAGCTATGTCACGAGAGTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-504s21c1
Sequence:CCGGTAGGGAGCATGGACTTATATTCTCGAGAATATAAGTCCATGCTCCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032846.2-221s21c1
Sequence:CCGGGAGCTCGTATGGTCAACATTGCTCGAGCAATGTTGACCATACGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-502s1c1
Sequence:CCGGGCTAGGGAGCATGGACTTATACTCGAGTATAAGTCCATGCTCCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-223s1c1
Sequence:CCGGGCTCGTATGGTCAACATTGATCTCGAGATCAATGTTGACCATACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032846.2-565s1c1
Sequence:CCGGGCCTTCATTAACACAGCCAAACTCGAGTTTGGCTGTGTTAATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032846.2-198s1c1
Sequence:CCGGCCTCACAATAGGTGTGGAGTTCTCGAGAACTCCACACCTATTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032846.2-405s1c1
Sequence:CCGGGCAGCACTCTAGTTCCAACATCTCGAGATGTTGGAACTAGAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)