EMAIL THIS PAGE TO A FRIEND

RAB30

RAB30, member RAS oncogene family

103 Gene Product Result for
UniProtKB ID: Q15771, Q6FGK1, Q96CI8
Gene ID:
Mouse(75985) RAB30, member RAS oncogene family
Rat(308821) RAB30, member RAS oncogene family
fruit fly(33988) CG9100 gene product from transcript CG9100-RB
chicken(419020) RAB30, member RAS oncogene family
domestic cat(101100151) RAB30, member RAS oncogene family
dog(476787) RAB30, member RAS oncogene family
Zebrafish(437023) RAB30, member RAS oncogene family
domestic guinea pig(100734061) RAB30, member RAS oncogene family
cow(540583) RAB30, member RAS oncogene family
sheep(101107234) RAB30, member RAS oncogene family
Goat(100861132) RAB30, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014488 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014488 Rosetta Predictions human pricing
NM_001015012 Rosetta Predictions rat pricing
NM_029494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041557 predicted 1030
2 SASI_Hs01_00041558 predicted 602
3 SASI_Hs01_00041559 predicted 511
4 SASI_Hs01_00041561 predicted 784
5 SASI_Hs02_00345737 predicted 781
6 SASI_Hs01_00041562 predicted 810
7 SASI_Hs01_00041563 predicted 842
8 SASI_Hs01_00041564 predicted 571
9 SASI_Hs01_00041565 predicted 778
10 SASI_Hs01_00041566 predicted 797
11 SASI_Hs01_00041560 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201991 predicted 299
2 SASI_Rn02_00201992 predicted 766
3 SASI_Rn02_00201993 predicted 455
4 SASI_Rn02_00201994 predicted 501
5 SASI_Rn02_00201995 predicted 607
6 SASI_Rn02_00201996 predicted 330
7 SASI_Rn02_00201997 predicted 525
8 SASI_Rn02_00201998 predicted 314
9 SASI_Rn02_00201999 predicted 561
10 SASI_Rn02_00202000 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075723 predicted 660
2 SASI_Mm01_00075724 predicted 345
3 SASI_Mm01_00075725 predicted 255
4 SASI_Mm01_00075727 predicted 479
5 SASI_Mm01_00075728 predicted 352
6 SASI_Mm01_00075729 predicted 672
7 SASI_Mm01_00075730 predicted 716
8 SASI_Mm01_00075731 predicted 343
9 SASI_Mm01_00075732 predicted 748
10 SASI_Mm02_00335430 predicted 382
11 SASI_Mm01_00075726 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029494
VALIDATED
RAB30 MISSION shRNA Bacterial Glycerol Stock
RAB30, member RAS oncogene family
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-389s21c1
Sequence:CCGGCTTGATCCTTACCTATGACATCTCGAGATGTCATAGGTAAGGATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-1466s21c1
Sequence:CCGGGCAGTCTTCTTCAGTCTCATTCTCGAGAATGAGACTGAAGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-450s21c1
Sequence:CCGGCGGGAGATAGAACAGTATGCTCTCGAGAGCATACTGTTCTATCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-1466s1c1
Sequence:CCGGGCAGTCTTCTTCAGTCTCATTCTCGAGAATGAGACTGAAGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-389s1c1
Sequence:CCGGCTTGATCCTTACCTATGACATCTCGAGATGTCATAGGTAAGGATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-450s1c1
Sequence:CCGGCGGGAGATAGAACAGTATGCTCTCGAGAGCATACTGTTCTATCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-719s1c1
Sequence:CCGGCAGCTATTTGACTTGTTGTAACTCGAGTTACAACAAGTCAAATAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-204s21c1
Sequence:CCGGACGTGCCTAGTCCGAAGATTCCTCGAGGAATCTTCGGACTAGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029494.2-216s1c1
Sequence:CCGGCGAAGATTCACTCAGGGTCTTCTCGAGAAGACCCTGAGTGAATCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029494
VALIDATED
RAB30 MISSION shRNA shRNA Plasmid DNA
RAB30, member RAS oncogene family
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-389s21c1
Sequence:CCGGCTTGATCCTTACCTATGACATCTCGAGATGTCATAGGTAAGGATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-1466s21c1
Sequence:CCGGGCAGTCTTCTTCAGTCTCATTCTCGAGAATGAGACTGAAGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-450s21c1
Sequence:CCGGCGGGAGATAGAACAGTATGCTCTCGAGAGCATACTGTTCTATCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-1466s1c1
Sequence:CCGGGCAGTCTTCTTCAGTCTCATTCTCGAGAATGAGACTGAAGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-389s1c1
Sequence:CCGGCTTGATCCTTACCTATGACATCTCGAGATGTCATAGGTAAGGATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-450s1c1
Sequence:CCGGCGGGAGATAGAACAGTATGCTCTCGAGAGCATACTGTTCTATCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-719s1c1
Sequence:CCGGCAGCTATTTGACTTGTTGTAACTCGAGTTACAACAAGTCAAATAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-204s21c1
Sequence:CCGGACGTGCCTAGTCCGAAGATTCCTCGAGGAATCTTCGGACTAGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029494.2-216s1c1
Sequence:CCGGCGAAGATTCACTCAGGGTCTTCTCGAGAAGACCCTGAGTGAATCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029494
VALIDATED
RAB30 MISSION shRNA Lentiviral Transduction Particles
RAB30, member RAS oncogene family
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-389s21c1
Sequence:CCGGCTTGATCCTTACCTATGACATCTCGAGATGTCATAGGTAAGGATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-1466s21c1
Sequence:CCGGGCAGTCTTCTTCAGTCTCATTCTCGAGAATGAGACTGAAGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-450s21c1
Sequence:CCGGCGGGAGATAGAACAGTATGCTCTCGAGAGCATACTGTTCTATCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-1466s1c1
Sequence:CCGGGCAGTCTTCTTCAGTCTCATTCTCGAGAATGAGACTGAAGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-389s1c1
Sequence:CCGGCTTGATCCTTACCTATGACATCTCGAGATGTCATAGGTAAGGATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-450s1c1
Sequence:CCGGCGGGAGATAGAACAGTATGCTCTCGAGAGCATACTGTTCTATCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029494.2-719s1c1
Sequence:CCGGCAGCTATTTGACTTGTTGTAACTCGAGTTACAACAAGTCAAATAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029494.2-204s21c1
Sequence:CCGGACGTGCCTAGTCCGAAGATTCCTCGAGGAATCTTCGGACTAGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029494.2-216s1c1
Sequence:CCGGCGAAGATTCACTCAGGGTCTTCTCGAGAAGACCCTGAGTGAATCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014488
RAB30 MISSION shRNA Bacterial Glycerol Stock
RAB30, member RAS oncogene family
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-839s1c1
Sequence:CCGGGCATCAGCTATTTGACTTGTTCTCGAGAACAAGTCAAATAGCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-341s1c1
Sequence:CCGGGAAGATTCACTCAGGGTCTTTCTCGAGAAAGACCCTGAGTGAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014488.3-491s21c1
Sequence:CCGGGTTACTACCGAAGCGCCAATGCTCGAGCATTGGCGCTTCGGTAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-463s1c1
Sequence:CCGGCAAGAGAGATTTCGGTCCATTCTCGAGAATGGACCGAAATCTCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-801s1c1
Sequence:CCGGGAACAATGTATCCTCACCCTTCTCGAGAAGGGTGAGGATACATTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-571s1c1
Sequence:CCGGCTGCGGGAGATAGAACAATATCTCGAGATATTGTTCTATCTCCCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014488
RAB30 MISSION shRNA shRNA Plasmid DNA
RAB30, member RAS oncogene family
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-839s1c1
Sequence:CCGGGCATCAGCTATTTGACTTGTTCTCGAGAACAAGTCAAATAGCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-341s1c1
Sequence:CCGGGAAGATTCACTCAGGGTCTTTCTCGAGAAAGACCCTGAGTGAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014488.3-491s21c1
Sequence:CCGGGTTACTACCGAAGCGCCAATGCTCGAGCATTGGCGCTTCGGTAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-463s1c1
Sequence:CCGGCAAGAGAGATTTCGGTCCATTCTCGAGAATGGACCGAAATCTCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-801s1c1
Sequence:CCGGGAACAATGTATCCTCACCCTTCTCGAGAAGGGTGAGGATACATTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-571s1c1
Sequence:CCGGCTGCGGGAGATAGAACAATATCTCGAGATATTGTTCTATCTCCCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014488
RAB30 MISSION shRNA Lentiviral Transduction Particles
RAB30, member RAS oncogene family
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-839s1c1
Sequence:CCGGGCATCAGCTATTTGACTTGTTCTCGAGAACAAGTCAAATAGCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-341s1c1
Sequence:CCGGGAAGATTCACTCAGGGTCTTTCTCGAGAAAGACCCTGAGTGAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014488.3-491s21c1
Sequence:CCGGGTTACTACCGAAGCGCCAATGCTCGAGCATTGGCGCTTCGGTAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-463s1c1
Sequence:CCGGCAAGAGAGATTTCGGTCCATTCTCGAGAATGGACCGAAATCTCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-801s1c1
Sequence:CCGGGAACAATGTATCCTCACCCTTCTCGAGAAGGGTGAGGATACATTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014488.3-571s1c1
Sequence:CCGGCTGCGGGAGATAGAACAATATCTCGAGATATTGTTCTATCTCCCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)