EMAIL THIS PAGE TO A FRIEND

RAB32

RAB32, member RAS oncogene family

42 Gene Product Result for
UniProtKB ID: Q13637
Gene ID:
Human(10981) Summary: Small GTP-binding proteins of the RAB family, such as RAB32, play essential roles in vesicle and granule targeting (Bao et al., 2002 [PubMed 11784320]
Mouse(67844) RAB32, member RAS oncogene family
Rat(365042) RAB32, member RAS oncogene family
naked mole-rat(101712134) RAB32, member RAS oncogene family
domestic guinea pig(100730329) RAB32, member RAS oncogene family
cow(528099) RAB32, member RAS oncogene family
chicken(421616) RAB32, member RAS oncogene family
domestic cat(101094599) RAB32, member RAS oncogene family
dog(476234) RAB32, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006834 Rosetta Predictions human pricing
NM_001108902 Rosetta Predictions rat pricing
NM_026405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212391 predicted 910
2 SASI_Hs02_00342400 predicted 589
3 SASI_Hs01_00212392 predicted 443
4 SASI_Hs01_00212393 predicted 943
5 SASI_Hs01_00212394 predicted 876
6 SASI_Hs01_00212395 predicted 839
7 SASI_Hs01_00212396 predicted 578
8 SASI_Hs01_00212397 predicted 938
9 SASI_Hs01_00212398 predicted 466
10 SASI_Hs01_00212400 predicted 925
11 SASI_Hs01_00212399 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243215 predicted 206
2 SASI_Rn02_00243216 predicted 603
3 SASI_Rn02_00243217 predicted 632
4 SASI_Rn02_00243218 predicted 967
5 SASI_Rn02_00243219 predicted 899
6 SASI_Rn02_00243220 predicted 1013
7 SASI_Rn02_00243221 predicted 401
8 SASI_Rn02_00243222 predicted 924
9 SASI_Rn02_00243223 predicted 431
10 SASI_Rn02_00243224 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050365 predicted 1228
2 SASI_Mm01_00050366 predicted 898
3 SASI_Mm01_00050367 predicted 717
4 SASI_Mm01_00050368 predicted 626
5 SASI_Mm01_00050369 predicted 375
6 SASI_Mm01_00050370 predicted 954
7 SASI_Mm01_00050371 predicted 992
8 SASI_Mm01_00050372 predicted 411
9 SASI_Mm01_00050373 predicted 735
10 SASI_Mm01_00050374 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006834
VALIDATED
RAB32 MISSION shRNA Bacterial Glycerol Stock
RAB32, member RAS oncogene family
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006834.3-824s21c1
Sequence:CCGGCCTTGAGAGCAGAGAACAAATCTCGAGATTTGTTCTCTGCTCTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-460s21c1
Sequence:CCGGGTATACTACAAGGAAGCTGTTCTCGAGAACAGCTTCCTTGTAGTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006834.3-649s21c1
Sequence:CCGGCAGGTGGACCAATTCTGCAAACTCGAGTTTGCAGAATTGGTCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-752s21c1
Sequence:CCGGAGATTCTTGTAAACCACCAAACTCGAGTTTGGTGGTTTACAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-698s21c1
Sequence:CCGGCCTCTGCAAAGGATAACATAACTCGAGTTATGTTATCCTTTGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006834.3-1027s21c1
Sequence:GTACCGGGCTAGTGGCTCTGTAACTTAACTCGAGTTAAGTTACAGAGCCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-700s1c1
Sequence:CCGGCCTCTGCAAAGGATAACATAACTCGAGTTATGTTATCCTTTGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-754s1c1
Sequence:CCGGAGATTCTTGTAAACCACCAAACTCGAGTTTGGTGGTTTACAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-826s1c1
Sequence:CCGGCCTTGAGAGCAGAGAACAAATCTCGAGATTTGTTCTCTGCTCTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006834.3-902s21c1
Sequence:GTACCGGAGTTCCTGAGAATGGGTTACACTCGAGTGTAACCCATTCTCAGGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-462s1c1
Sequence:CCGGGTATACTACAAGGAAGCTGTTCTCGAGAACAGCTTCCTTGTAGTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006834.2-651s1c1
Sequence:CCGGCAGGTGGACCAATTCTGCAAACTCGAGTTTGCAGAATTGGTCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006834
VALIDATED
RAB32 MISSION shRNA shRNA Plasmid DNA
RAB32, member RAS oncogene family
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006834.3-824s21c1
Sequence:CCGGCCTTGAGAGCAGAGAACAAATCTCGAGATTTGTTCTCTGCTCTCAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000299370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-460s21c1
Sequence:CCGGGTATACTACAAGGAAGCTGTTCTCGAGAACAGCTTCCTTGTAGTATACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000299371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006834.3-649s21c1
Sequence:CCGGCAGGTGGACCAATTCTGCAAACTCGAGTTTGCAGAATTGGTCCACCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000299369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-752s21c1
Sequence:CCGGAGATTCTTGTAAACCACCAAACTCGAGTTTGGTGGTTTACAAGAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000299448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-698s21c1
Sequence:CCGGCCTCTGCAAAGGATAACATAACTCGAGTTATGTTATCCTTTGCAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000381953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006834.3-1027s21c1
Sequence:GTACCGGGCTAGTGGCTCTGTAACTTAACTCGAGTTAAGTTACAGAGCCACTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000047743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-700s1c1
Sequence:CCGGCCTCTGCAAAGGATAACATAACTCGAGTTATGTTATCCTTTGCAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000047747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-754s1c1
Sequence:CCGGAGATTCTTGTAAACCACCAAACTCGAGTTTGGTGGTTTACAAGAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000047744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-826s1c1
Sequence:CCGGCCTTGAGAGCAGAGAACAAATCTCGAGATTTGTTCTCTGCTCTCAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000381872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006834.3-902s21c1
Sequence:GTACCGGAGTTCCTGAGAATGGGTTACACTCGAGTGTAACCCATTCTCAGGAACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000047745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-462s1c1
Sequence:CCGGGTATACTACAAGGAAGCTGTTCTCGAGAACAGCTTCCTTGTAGTATACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000047746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006834.2-651s1c1
Sequence:CCGGCAGGTGGACCAATTCTGCAAACTCGAGTTTGCAGAATTGGTCCACCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006834
VALIDATED
RAB32 MISSION shRNA Lentiviral Transduction Particles
RAB32, member RAS oncogene family
Human
12 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000299445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006834.3-824s21c1
Sequence:CCGGCCTTGAGAGCAGAGAACAAATCTCGAGATTTGTTCTCTGCTCTCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-460s21c1
Sequence:CCGGGTATACTACAAGGAAGCTGTTCTCGAGAACAGCTTCCTTGTAGTATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006834.3-649s21c1
Sequence:CCGGCAGGTGGACCAATTCTGCAAACTCGAGTTTGCAGAATTGGTCCACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-752s21c1
Sequence:CCGGAGATTCTTGTAAACCACCAAACTCGAGTTTGGTGGTTTACAAGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006834.3-698s21c1
Sequence:CCGGCCTCTGCAAAGGATAACATAACTCGAGTTATGTTATCCTTTGCAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006834.3-1027s21c1
Sequence:GTACCGGGCTAGTGGCTCTGTAACTTAACTCGAGTTAAGTTACAGAGCCACTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-700s1c1
Sequence:CCGGCCTCTGCAAAGGATAACATAACTCGAGTTATGTTATCCTTTGCAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-754s1c1
Sequence:CCGGAGATTCTTGTAAACCACCAAACTCGAGTTTGGTGGTTTACAAGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-826s1c1
Sequence:CCGGCCTTGAGAGCAGAGAACAAATCTCGAGATTTGTTCTCTGCTCTCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006834.3-902s21c1
Sequence:GTACCGGAGTTCCTGAGAATGGGTTACACTCGAGTGTAACCCATTCTCAGGAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006834.2-462s1c1
Sequence:CCGGGTATACTACAAGGAAGCTGTTCTCGAGAACAGCTTCCTTGTAGTATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006834.2-651s1c1
Sequence:CCGGCAGGTGGACCAATTCTGCAAACTCGAGTTTGCAGAATTGGTCCACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026405
VALIDATED
RAB32 MISSION shRNA Bacterial Glycerol Stock
RAB32, member RAS oncogene family
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026405.3-1698s21c1
Sequence:CCGGGCCAAGTTTCTGTAGTGTAAACTCGAGTTTACACTACAGAAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-412s21c1
Sequence:CCGGTTGGAGCATTTGTAGTCTTTGCTCGAGCAAAGACTACAAATGCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-631s21c1
Sequence:CCGGCCTCTGCCAAGGATAATATAACTCGAGTTATATTATCCTTGGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-291s21c1
Sequence:GTACCGGGTGGACTTCGCCCTCAAAGTTCTCGAGAACTTTGAGGGCGAAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-219s1c1
Sequence:CCGGCGTGGGTAAGACGAGCATCATCTCGAGATGATGCTCGTCTTACCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026405.2-1699s1c1
Sequence:CCGGGCCAAGTTTCTGTAGTGTAAACTCGAGTTTACACTACAGAAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026405.2-632s1c1
Sequence:CCGGCCTCTGCCAAGGATAATATAACTCGAGTTATATTATCCTTGGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-449s1c1
Sequence:CCGGCTACATTTGATGCAGTCCTAACTCGAGTTAGGACTGCATCAAATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-721s1c1
Sequence:CCGGGAAATCGACCTGGACAGAATTCTCGAGAATTCTGTCCAGGTCGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-526s21c1
Sequence:CCGGCTGTCCTCCTAGCTAACAAATCTCGAGATTTGTTAGCTAGGAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-174s21c1
Sequence:CCGGACCCGAGAGCACCTCTTTAAGCTCGAGCTTAAAGAGGTGCTCTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-724s21c1
Sequence:GTACCGGTCGACCTGGACAGAATTAAACCTCGAGGTTTAATTCTGTCCAGGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026405
VALIDATED
RAB32 MISSION shRNA shRNA Plasmid DNA
RAB32, member RAS oncogene family
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026405.3-1698s21c1
Sequence:CCGGGCCAAGTTTCTGTAGTGTAAACTCGAGTTTACACTACAGAAACTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000295715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-412s21c1
Sequence:CCGGTTGGAGCATTTGTAGTCTTTGCTCGAGCAAAGACTACAAATGCTCCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000288451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-631s21c1
Sequence:CCGGCCTCTGCCAAGGATAATATAACTCGAGTTATATTATCCTTGGCAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000381908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-291s21c1
Sequence:GTACCGGGTGGACTTCGCCCTCAAAGTTCTCGAGAACTTTGAGGGCGAAGTCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-219s1c1
Sequence:CCGGCGTGGGTAAGACGAGCATCATCTCGAGATGATGCTCGTCTTACCCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026405.2-1699s1c1
Sequence:CCGGGCCAAGTTTCTGTAGTGTAAACTCGAGTTTACACTACAGAAACTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026405.2-632s1c1
Sequence:CCGGCCTCTGCCAAGGATAATATAACTCGAGTTATATTATCCTTGGCAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-449s1c1
Sequence:CCGGCTACATTTGATGCAGTCCTAACTCGAGTTAGGACTGCATCAAATGTAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000102689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-721s1c1
Sequence:CCGGGAAATCGACCTGGACAGAATTCTCGAGAATTCTGTCCAGGTCGATTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000295716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-526s21c1
Sequence:CCGGCTGTCCTCCTAGCTAACAAATCTCGAGATTTGTTAGCTAGGAGGACAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000295775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-174s21c1
Sequence:CCGGACCCGAGAGCACCTCTTTAAGCTCGAGCTTAAAGAGGTGCTCTCGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000381733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-724s21c1
Sequence:GTACCGGTCGACCTGGACAGAATTAAACCTCGAGGTTTAATTCTGTCCAGGTCGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026405
VALIDATED
RAB32 MISSION shRNA Lentiviral Transduction Particles
RAB32, member RAS oncogene family
Mouse
12 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000288450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026405.3-1698s21c1
Sequence:CCGGGCCAAGTTTCTGTAGTGTAAACTCGAGTTTACACTACAGAAACTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-412s21c1
Sequence:CCGGTTGGAGCATTTGTAGTCTTTGCTCGAGCAAAGACTACAAATGCTCCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-631s21c1
Sequence:CCGGCCTCTGCCAAGGATAATATAACTCGAGTTATATTATCCTTGGCAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-291s21c1
Sequence:GTACCGGGTGGACTTCGCCCTCAAAGTTCTCGAGAACTTTGAGGGCGAAGTCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-219s1c1
Sequence:CCGGCGTGGGTAAGACGAGCATCATCTCGAGATGATGCTCGTCTTACCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026405.2-1699s1c1
Sequence:CCGGGCCAAGTTTCTGTAGTGTAAACTCGAGTTTACACTACAGAAACTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026405.2-632s1c1
Sequence:CCGGCCTCTGCCAAGGATAATATAACTCGAGTTATATTATCCTTGGCAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-449s1c1
Sequence:CCGGCTACATTTGATGCAGTCCTAACTCGAGTTAGGACTGCATCAAATGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026405.2-721s1c1
Sequence:CCGGGAAATCGACCTGGACAGAATTCTCGAGAATTCTGTCCAGGTCGATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-526s21c1
Sequence:CCGGCTGTCCTCCTAGCTAACAAATCTCGAGATTTGTTAGCTAGGAGGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-174s21c1
Sequence:CCGGACCCGAGAGCACCTCTTTAAGCTCGAGCTTAAAGAGGTGCTCTCGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026405.3-724s21c1
Sequence:GTACCGGTCGACCTGGACAGAATTAAACCTCGAGGTTTAATTCTGTCCAGGTCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)