EMAIL THIS PAGE TO A FRIEND

RAB33B

RAB33B, member RAS oncogene family

94 Gene Product Result for
Synonyms: SMC2
UniProtKB ID: Q9H082, B2R987, Q4W5B0
Gene ID:
Human(83452) Summary: Small GTP-binding proteins of the RAB family, such as RAB33B, play important roles at defined steps of vesicular transport in protein secretion and the endocytosis pathway (Zheng et al., 1998 [PubMed 9512502]
Mouse(19338) RAB33B, member of RAS oncogene family
Rat(365793) RAB33B, member RAS oncogene family
naked mole-rat(101715124) RAB33B, member RAS oncogene family
domestic guinea pig(100716763) RAB33B, member RAS oncogene family
cow(519982) RAB33B, member RAS oncogene family
sheep(101105602) RAB33B, member RAS oncogene family
chicken(422441) RAB33B, member RAS oncogene family
dog(100685754) RAB33B, member RAS oncogene family
domestic cat(101098378) RAB33B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031296 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031296 Rosetta Predictions human pricing
NM_001108944 Rosetta Predictions rat pricing
NM_016858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358731 predicted 714
2 SASI_Hs01_00122468 predicted 974
3 SASI_Hs01_00122469 predicted 904
4 SASI_Hs01_00122470 predicted 988
5 SASI_Hs01_00122471 predicted 1067
6 SASI_Hs01_00122472 predicted 788
7 SASI_Hs01_00122473 predicted 1131
8 SASI_Hs01_00122474 predicted 1016
9 SASI_Hs01_00122475 predicted 1125
10 SASI_Hs01_00122476 predicted 1159
11 SASI_Hs01_00122477 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243624 predicted 919
2 SASI_Rn02_00243625 predicted 830
3 SASI_Rn02_00243626 predicted 1147
4 SASI_Rn02_00243627 predicted 1083
5 SASI_Rn02_00243628 predicted 804
6 SASI_Rn02_00243629 predicted 1045
7 SASI_Rn02_00243630 predicted 860
8 SASI_Rn02_00243631 predicted 667
9 SASI_Rn02_00243632 predicted 943
10 SASI_Rn02_00243633 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057644 predicted 1134
2 SASI_Mm02_00323635 predicted 1114
3 SASI_Mm01_00057646 predicted 1084
4 SASI_Mm01_00057649 predicted 904
5 SASI_Mm02_00323636 predicted 989
6 SASI_Mm02_00323637 predicted 1082
7 SASI_Mm02_00323638 predicted 1123
8 SASI_Mm02_00323639 predicted 928
9 SASI_Mm02_00323640 predicted 1078
10 SASI_Mm01_00057641 predicted 886
11 SASI_Mm01_00057642 predicted 642
12 SASI_Mm01_00057643 predicted 749
13 SASI_Mm01_00057645 predicted 960
14 SASI_Mm01_00057647 predicted 743
15 SASI_Mm01_00057648 predicted 407
16 SASI_Mm01_00057650 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016858
VALIDATED
RAB33B MISSION shRNA Bacterial Glycerol Stock
RAB33B, member RAS oncogene family
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-985s21c1
Sequence:GTACCGGCTTAGCCAGCTGCCTGATAACCTCGAGGTTATCAGGCAGCTGGCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-458s21c1
Sequence:CCGGCCCGCATCTTCAAGATCATAGCTCGAGCTATGATCTTGAAGATGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-924s21c1
Sequence:CCGGCCACGTAGAAGCTATATTCATCTCGAGATGAATATAGCTTCTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016858.2-2380s21c1
Sequence:CCGGGCCCAATACATCTTTCTTAATCTCGAGATTAAGAAAGATGTATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-683s21c1
Sequence:CCGGATGTGCATGCTGTCGTCTTTGCTCGAGCAAAGACGACAGCATGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-579s21c1
Sequence:GTACCGGAGAGCGAGCCGTGGATATTGACTCGAGTCAATATCCACGGCTCGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-874s1c1
Sequence:CCGGCCACGTAGAAGCTATATTCATCTCGAGATGAATATAGCTTCTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-950s1c1
Sequence:CCGGGATAACAGAATTAGCCTGAAACTCGAGTTTCAGGCTAATTCTGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-695s1c1
Sequence:CCGGGCTTGGATAGAGGAATGCAAACTCGAGTTTGCATTCCTCTATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-2347s1c1
Sequence:CCGGGCCCAATACATCTTTCTTAATCTCGAGATTAAGAAAGATGTATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-770s21c1
Sequence:GTACCGGACTTGCTGGCGAACGACATACCTCGAGGTATGTCGTTCGCCAGCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-1043s21c1
Sequence:CCGGCTTGCTGGTGCTGAGTCATAGCTCGAGCTATGACTCAGCACCAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016858.1-728s1c1
Sequence:CCGGGCGAACGACATACCTCGAATTCTCGAGAATTCGAGGTATGTCGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016858
VALIDATED
RAB33B MISSION shRNA shRNA Plasmid DNA
RAB33B, member RAS oncogene family
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-985s21c1
Sequence:GTACCGGCTTAGCCAGCTGCCTGATAACCTCGAGGTTATCAGGCAGCTGGCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-458s21c1
Sequence:CCGGCCCGCATCTTCAAGATCATAGCTCGAGCTATGATCTTGAAGATGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-924s21c1
Sequence:CCGGCCACGTAGAAGCTATATTCATCTCGAGATGAATATAGCTTCTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016858.2-2380s21c1
Sequence:CCGGGCCCAATACATCTTTCTTAATCTCGAGATTAAGAAAGATGTATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-683s21c1
Sequence:CCGGATGTGCATGCTGTCGTCTTTGCTCGAGCAAAGACGACAGCATGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-579s21c1
Sequence:GTACCGGAGAGCGAGCCGTGGATATTGACTCGAGTCAATATCCACGGCTCGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-874s1c1
Sequence:CCGGCCACGTAGAAGCTATATTCATCTCGAGATGAATATAGCTTCTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-950s1c1
Sequence:CCGGGATAACAGAATTAGCCTGAAACTCGAGTTTCAGGCTAATTCTGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-695s1c1
Sequence:CCGGGCTTGGATAGAGGAATGCAAACTCGAGTTTGCATTCCTCTATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-2347s1c1
Sequence:CCGGGCCCAATACATCTTTCTTAATCTCGAGATTAAGAAAGATGTATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-770s21c1
Sequence:GTACCGGACTTGCTGGCGAACGACATACCTCGAGGTATGTCGTTCGCCAGCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-1043s21c1
Sequence:CCGGCTTGCTGGTGCTGAGTCATAGCTCGAGCTATGACTCAGCACCAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016858.1-728s1c1
Sequence:CCGGGCGAACGACATACCTCGAATTCTCGAGAATTCGAGGTATGTCGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016858
VALIDATED
RAB33B MISSION shRNA Lentiviral Transduction Particles
RAB33B, member RAS oncogene family
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-985s21c1
Sequence:GTACCGGCTTAGCCAGCTGCCTGATAACCTCGAGGTTATCAGGCAGCTGGCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-458s21c1
Sequence:CCGGCCCGCATCTTCAAGATCATAGCTCGAGCTATGATCTTGAAGATGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-924s21c1
Sequence:CCGGCCACGTAGAAGCTATATTCATCTCGAGATGAATATAGCTTCTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016858.2-2380s21c1
Sequence:CCGGGCCCAATACATCTTTCTTAATCTCGAGATTAAGAAAGATGTATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-683s21c1
Sequence:CCGGATGTGCATGCTGTCGTCTTTGCTCGAGCAAAGACGACAGCATGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-579s21c1
Sequence:GTACCGGAGAGCGAGCCGTGGATATTGACTCGAGTCAATATCCACGGCTCGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-874s1c1
Sequence:CCGGCCACGTAGAAGCTATATTCATCTCGAGATGAATATAGCTTCTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-950s1c1
Sequence:CCGGGATAACAGAATTAGCCTGAAACTCGAGTTTCAGGCTAATTCTGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-695s1c1
Sequence:CCGGGCTTGGATAGAGGAATGCAAACTCGAGTTTGCATTCCTCTATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016858.1-2347s1c1
Sequence:CCGGGCCCAATACATCTTTCTTAATCTCGAGATTAAGAAAGATGTATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-770s21c1
Sequence:GTACCGGACTTGCTGGCGAACGACATACCTCGAGGTATGTCGTTCGCCAGCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016858.2-1043s21c1
Sequence:CCGGCTTGCTGGTGCTGAGTCATAGCTCGAGCTATGACTCAGCACCAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016858.1-728s1c1
Sequence:CCGGGCGAACGACATACCTCGAATTCTCGAGAATTCGAGGTATGTCGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031296
VALIDATED
RAB33B MISSION shRNA Bacterial Glycerol Stock
RAB33B, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031296.1-2154s21c1
Sequence:CCGGCCGAGTTGCTTTCTTACTAAACTCGAGTTTAGTAAGAAAGCAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-1063s21c1
Sequence:CCGGTGACGTGCTGGTGCTAAATAACTCGAGTTATTTAGCACCAGCACGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-2153s1c1
Sequence:CCGGGCCGAGTTGCTTTCTTACTAACTCGAGTTAGTAAGAAAGCAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031296.1-761s1c1
Sequence:CCGGCCTACCATCTTGGATAGAAGACTCGAGTCTTCTATCCAAGATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-944s21c1
Sequence:CCGGTGACCATGTGGAAGCTATATTCTCGAGAATATAGCTTCCACATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-791s21c1
Sequence:GTACCGGACATTTGCTAGCCAATGATATCTCGAGATATCATTGGCTAGCAAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-480s21c1
Sequence:CCGGTCCCGCATCTTCAAGATAATCCTCGAGGATTATCTTGAAGATGCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-714s1c1
Sequence:CCGGGCTGTTGTCTTCGTGTATGATCTCGAGATCATACACGAAGACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031296.1-801s1c1
Sequence:CCGGGCCAATGATATACCACGGATTCTCGAGAATCCGTGGTATATCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-813s1c1
Sequence:CCGGCCACGGATTCTTGTTGGAAATCTCGAGATTTCCAACAAGAATCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031296
VALIDATED
RAB33B MISSION shRNA shRNA Plasmid DNA
RAB33B, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031296.1-2154s21c1
Sequence:CCGGCCGAGTTGCTTTCTTACTAAACTCGAGTTTAGTAAGAAAGCAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-1063s21c1
Sequence:CCGGTGACGTGCTGGTGCTAAATAACTCGAGTTATTTAGCACCAGCACGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-2153s1c1
Sequence:CCGGGCCGAGTTGCTTTCTTACTAACTCGAGTTAGTAAGAAAGCAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031296.1-761s1c1
Sequence:CCGGCCTACCATCTTGGATAGAAGACTCGAGTCTTCTATCCAAGATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-944s21c1
Sequence:CCGGTGACCATGTGGAAGCTATATTCTCGAGAATATAGCTTCCACATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-791s21c1
Sequence:GTACCGGACATTTGCTAGCCAATGATATCTCGAGATATCATTGGCTAGCAAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-480s21c1
Sequence:CCGGTCCCGCATCTTCAAGATAATCCTCGAGGATTATCTTGAAGATGCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-714s1c1
Sequence:CCGGGCTGTTGTCTTCGTGTATGATCTCGAGATCATACACGAAGACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031296.1-801s1c1
Sequence:CCGGGCCAATGATATACCACGGATTCTCGAGAATCCGTGGTATATCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-813s1c1
Sequence:CCGGCCACGGATTCTTGTTGGAAATCTCGAGATTTCCAACAAGAATCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031296
VALIDATED
RAB33B MISSION shRNA Lentiviral Transduction Particles
RAB33B, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031296.1-2154s21c1
Sequence:CCGGCCGAGTTGCTTTCTTACTAAACTCGAGTTTAGTAAGAAAGCAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-1063s21c1
Sequence:CCGGTGACGTGCTGGTGCTAAATAACTCGAGTTATTTAGCACCAGCACGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-2153s1c1
Sequence:CCGGGCCGAGTTGCTTTCTTACTAACTCGAGTTAGTAAGAAAGCAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031296.1-761s1c1
Sequence:CCGGCCTACCATCTTGGATAGAAGACTCGAGTCTTCTATCCAAGATGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-944s21c1
Sequence:CCGGTGACCATGTGGAAGCTATATTCTCGAGAATATAGCTTCCACATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-791s21c1
Sequence:GTACCGGACATTTGCTAGCCAATGATATCTCGAGATATCATTGGCTAGCAAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031296.1-480s21c1
Sequence:CCGGTCCCGCATCTTCAAGATAATCCTCGAGGATTATCTTGAAGATGCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-714s1c1
Sequence:CCGGGCTGTTGTCTTCGTGTATGATCTCGAGATCATACACGAAGACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031296.1-801s1c1
Sequence:CCGGGCCAATGATATACCACGGATTCTCGAGAATCCGTGGTATATCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031296.1-813s1c1
Sequence:CCGGCCACGGATTCTTGTTGGAAATCTCGAGATTTCCAACAAGAATCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)