EMAIL THIS PAGE TO A FRIEND

RAB34

RAB34, member RAS oncogene family

123 Gene Product Result for
Synonyms: RAB39 RAH
UniProtKB ID: Q9BZG1, B4E3A0, E9PEJ9, Q5BJE6, Q8NCJ8, Q96AR4
Gene ID:
Human(83871) Summary: This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. This gene overlaps and shares exon structure with the nine-amino acid residue-repeats (NARR) gene, which encodes a functionally distinct nucleolar protein from a different reading frame. [provided by RefSeq, Jan 2012]
Mouse(19376) RAB34, member of RAS oncogene family
Rat(360571) RAB34, member RAS oncogene family
dog(612952) RAB34, member RAS oncogene family
domestic cat(101096856) RAB34, member RAS oncogene family
cow(282028) RAB34, member RAS oncogene family
sheep(101106951) RAB34, member RAS oncogene family
naked mole-rat(101713984) RAB34, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031934 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084391 MISSION® esiRNA esiRNA human RAB34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031934 Rosetta Predictions human pricing
NM_001012140 Rosetta Predictions rat pricing
XM_573149 Rosetta Predictions rat pricing
NM_033475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102532 predicted 673
2 SASI_Hs01_00102533 predicted 852
3 SASI_Hs01_00102534 predicted 1233
4 SASI_Hs01_00102536 predicted 817
5 SASI_Hs02_00359068 predicted 972
6 SASI_Hs02_00359069 predicted 672
7 SASI_Hs02_00359070 predicted 1067
8 SASI_Hs02_00359071 predicted 1455
9 SASI_Hs01_00102538 predicted 869
10 SASI_Hs01_00102539 predicted 860
11 SASI_Hs01_00102530 predicted 1080
12 SASI_Hs01_00102531 predicted 833
13 SASI_Hs01_00102535 predicted 932
14 SASI_Hs01_00102537 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077024 predicted 232
2 SASI_Rn01_00077025 predicted 953
3 SASI_Rn01_00077026 predicted 356
4 SASI_Rn01_00077027 predicted 538
5 SASI_Rn01_00077028 predicted 439
6 SASI_Rn01_00077029 predicted 724
7 SASI_Rn01_00077030 predicted 676
8 SASI_Rn01_00077031 predicted 902
9 SASI_Rn01_00077032 predicted 803
10 SASI_Rn02_00200312 predicted 375
11 SASI_Rn01_00077023 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181300 predicted 1146
2 SASI_Rn01_00181301 predicted 671
3 SASI_Rn01_00181302 predicted 1386
4 SASI_Rn01_00181303 predicted 797
5 SASI_Rn01_00181304 predicted 970
6 SASI_Rn01_00181305 predicted 883
7 SASI_Rn01_00181306 predicted 1160
8 SASI_Rn01_00181307 predicted 1115
9 SASI_Rn01_00181308 predicted 1342
10 SASI_Rn01_00181309 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024762 predicted 1139
2 SASI_Mm01_00024763 predicted 698
3 SASI_Mm01_00024764 predicted 774
4 SASI_Mm01_00024765 predicted 1058
5 SASI_Mm01_00024766 predicted 1009
6 SASI_Mm01_00024767 predicted 1353
7 SASI_Mm01_00024768 predicted 866
8 SASI_Mm02_00337361 predicted 1262
9 SASI_Mm01_00024769 predicted 713
10 SASI_Mm01_00024770 predicted 728
11 SASI_Mm01_00024771 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033475
VALIDATED
RAB34 MISSION shRNA Bacterial Glycerol Stock
RAB34, member RAS oncogene family
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1142s1c1
Sequence:CCGGGCACTAACCTTTGAGGCCAATCTCGAGATTGGCCTCAAAGGTTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033475.2-643s1c1
Sequence:CCGGCGTGGGATTTAAGATATCCAACTCGAGTTGGATATCTTAAATCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-1280s21c1
Sequence:CCGGCGGCACATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033475.3-779s21c1
Sequence:GTACCGGGGGAAGACCTGTCTCATTAATCTCGAGATTAATGAGACAGGTCTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1355s1c1
Sequence:CCGGCCTGGACATTTGCACTGACTTCTCGAGAAGTCAGTGCAAATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1193s1c1
Sequence:CCGGCGGCACATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033475.2-1063s1c1
Sequence:CCGGCCAAGAGATTAAGGCCGAGTACTCGAGTACTCGGCCTTAATCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-1098s21c1
Sequence:CCGGTGAGTACTCCTGCTCAGTATTCTCGAGAATACTGAGCAGGAGTACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-805s21c1
Sequence:CCGGCTGCAAAGACACCTTCGATAACTCGAGTTATCGAAGGTGTCTTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-835s21c1
Sequence:CCGGGGCTACCATCGGAGTGGATTTCTCGAGAAATCCACTCCGATGGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-755s21c1
Sequence:CCGGATCGTTGTGGGAGACCTATCTCTCGAGAGATAGGTCTCCCACAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-721s21c1
Sequence:GTACCGGGACAGGCACCGTGGGATTTAACTCGAGTTAAATCCCACGGTGCCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033475
VALIDATED
RAB34 MISSION shRNA shRNA Plasmid DNA
RAB34, member RAS oncogene family
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1142s1c1
Sequence:CCGGGCACTAACCTTTGAGGCCAATCTCGAGATTGGCCTCAAAGGTTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033475.2-643s1c1
Sequence:CCGGCGTGGGATTTAAGATATCCAACTCGAGTTGGATATCTTAAATCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-1280s21c1
Sequence:CCGGCGGCACATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033475.3-779s21c1
Sequence:GTACCGGGGGAAGACCTGTCTCATTAATCTCGAGATTAATGAGACAGGTCTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1355s1c1
Sequence:CCGGCCTGGACATTTGCACTGACTTCTCGAGAAGTCAGTGCAAATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1193s1c1
Sequence:CCGGCGGCACATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033475.2-1063s1c1
Sequence:CCGGCCAAGAGATTAAGGCCGAGTACTCGAGTACTCGGCCTTAATCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-1098s21c1
Sequence:CCGGTGAGTACTCCTGCTCAGTATTCTCGAGAATACTGAGCAGGAGTACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-805s21c1
Sequence:CCGGCTGCAAAGACACCTTCGATAACTCGAGTTATCGAAGGTGTCTTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-835s21c1
Sequence:CCGGGGCTACCATCGGAGTGGATTTCTCGAGAAATCCACTCCGATGGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-755s21c1
Sequence:CCGGATCGTTGTGGGAGACCTATCTCTCGAGAGATAGGTCTCCCACAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-721s21c1
Sequence:GTACCGGGACAGGCACCGTGGGATTTAACTCGAGTTAAATCCCACGGTGCCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033475
VALIDATED
RAB34 MISSION shRNA Lentiviral Transduction Particles
RAB34, member RAS oncogene family
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1142s1c1
Sequence:CCGGGCACTAACCTTTGAGGCCAATCTCGAGATTGGCCTCAAAGGTTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033475.2-643s1c1
Sequence:CCGGCGTGGGATTTAAGATATCCAACTCGAGTTGGATATCTTAAATCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-1280s21c1
Sequence:CCGGCGGCACATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033475.3-779s21c1
Sequence:GTACCGGGGGAAGACCTGTCTCATTAATCTCGAGATTAATGAGACAGGTCTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1355s1c1
Sequence:CCGGCCTGGACATTTGCACTGACTTCTCGAGAAGTCAGTGCAAATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033475.2-1193s1c1
Sequence:CCGGCGGCACATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033475.2-1063s1c1
Sequence:CCGGCCAAGAGATTAAGGCCGAGTACTCGAGTACTCGGCCTTAATCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-1098s21c1
Sequence:CCGGTGAGTACTCCTGCTCAGTATTCTCGAGAATACTGAGCAGGAGTACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-805s21c1
Sequence:CCGGCTGCAAAGACACCTTCGATAACTCGAGTTATCGAAGGTGTCTTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-835s21c1
Sequence:CCGGGGCTACCATCGGAGTGGATTTCTCGAGAAATCCACTCCGATGGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-755s21c1
Sequence:CCGGATCGTTGTGGGAGACCTATCTCTCGAGAGATAGGTCTCCCACAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033475.3-721s21c1
Sequence:GTACCGGGACAGGCACCGTGGGATTTAACTCGAGTTAAATCCCACGGTGCCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031934
RAB34 MISSION shRNA Bacterial Glycerol Stock
RAB34, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-1118s1c1
Sequence:CCGGCCCTGCTCAGTATGCGCTGATCTCGAGATCAGCGCATACTGAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-803s1c1
Sequence:CCGGCCTCATTAATAGGTTCTGCAACTCGAGTTGCAGAACCTATTAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-949s1c1
Sequence:CCGGGCATTGCATCAACCTACTATACTCGAGTATAGTAGGTTGATGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-864s1c1
Sequence:CCGGGACTTCGAGATGGAACGATTTCTCGAGAAATCGTTCCATCTCGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031934.5-1480s21c1
Sequence:GTACCGGTGGACATTTGCACTGACTTTACTCGAGTAAAGTCAGTGCAAATGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-1242s1c1
Sequence:CCGGGCACTGACCTTTGAGGCCAATCTCGAGATTGGCCTCAAAGGTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-814s21c1
Sequence:GTACCGGGGGAAGACTTGCCTCATTAATCTCGAGATTAATGAGGCAAGTCTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-972s21c1
Sequence:GTACCGGCATTGCATCAACCTACTATAGCTCGAGCTATAGTAGGTTGATGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-995s21c1
Sequence:GTACCGGGAGCTCAAGCCATCATCATTGCTCGAGCAATGATGATGGCTTGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-1148s21c1
Sequence:GTACCGGAGTATGCGCTGATGGAGAAAGCTCGAGCTTTCTCCATCAGCGCATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-847s21c1
Sequence:GTACCGGGACACCTTTGATAAGAATTACCTCGAGGTAATTCTTATCAAAGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031934.5-1516s21c1
Sequence:GTACCGGTGCCTCTTGGTGGCAGTATTCCTCGAGGAATACTGCCACCAAGAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-887s21c1
Sequence:GTACCGGACTTCGAGATGGAACGATTTGCTCGAGCAAATCGTTCCATCTCGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031934
RAB34 MISSION shRNA shRNA Plasmid DNA
RAB34, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-1118s1c1
Sequence:CCGGCCCTGCTCAGTATGCGCTGATCTCGAGATCAGCGCATACTGAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-803s1c1
Sequence:CCGGCCTCATTAATAGGTTCTGCAACTCGAGTTGCAGAACCTATTAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-949s1c1
Sequence:CCGGGCATTGCATCAACCTACTATACTCGAGTATAGTAGGTTGATGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-864s1c1
Sequence:CCGGGACTTCGAGATGGAACGATTTCTCGAGAAATCGTTCCATCTCGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031934.5-1480s21c1
Sequence:GTACCGGTGGACATTTGCACTGACTTTACTCGAGTAAAGTCAGTGCAAATGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-1242s1c1
Sequence:CCGGGCACTGACCTTTGAGGCCAATCTCGAGATTGGCCTCAAAGGTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-814s21c1
Sequence:GTACCGGGGGAAGACTTGCCTCATTAATCTCGAGATTAATGAGGCAAGTCTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-972s21c1
Sequence:GTACCGGCATTGCATCAACCTACTATAGCTCGAGCTATAGTAGGTTGATGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-995s21c1
Sequence:GTACCGGGAGCTCAAGCCATCATCATTGCTCGAGCAATGATGATGGCTTGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-1148s21c1
Sequence:GTACCGGAGTATGCGCTGATGGAGAAAGCTCGAGCTTTCTCCATCAGCGCATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-847s21c1
Sequence:GTACCGGGACACCTTTGATAAGAATTACCTCGAGGTAATTCTTATCAAAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031934.5-1516s21c1
Sequence:GTACCGGTGCCTCTTGGTGGCAGTATTCCTCGAGGAATACTGCCACCAAGAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-887s21c1
Sequence:GTACCGGACTTCGAGATGGAACGATTTGCTCGAGCAAATCGTTCCATCTCGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031934
RAB34 MISSION shRNA Lentiviral Transduction Particles
RAB34, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-1118s1c1
Sequence:CCGGCCCTGCTCAGTATGCGCTGATCTCGAGATCAGCGCATACTGAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-803s1c1
Sequence:CCGGCCTCATTAATAGGTTCTGCAACTCGAGTTGCAGAACCTATTAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-949s1c1
Sequence:CCGGGCATTGCATCAACCTACTATACTCGAGTATAGTAGGTTGATGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-864s1c1
Sequence:CCGGGACTTCGAGATGGAACGATTTCTCGAGAAATCGTTCCATCTCGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031934.5-1480s21c1
Sequence:GTACCGGTGGACATTTGCACTGACTTTACTCGAGTAAAGTCAGTGCAAATGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031934.3-1242s1c1
Sequence:CCGGGCACTGACCTTTGAGGCCAATCTCGAGATTGGCCTCAAAGGTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-814s21c1
Sequence:GTACCGGGGGAAGACTTGCCTCATTAATCTCGAGATTAATGAGGCAAGTCTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-972s21c1
Sequence:GTACCGGCATTGCATCAACCTACTATAGCTCGAGCTATAGTAGGTTGATGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-995s21c1
Sequence:GTACCGGGAGCTCAAGCCATCATCATTGCTCGAGCAATGATGATGGCTTGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-1148s21c1
Sequence:GTACCGGAGTATGCGCTGATGGAGAAAGCTCGAGCTTTCTCCATCAGCGCATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-847s21c1
Sequence:GTACCGGGACACCTTTGATAAGAATTACCTCGAGGTAATTCTTATCAAAGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031934.5-1516s21c1
Sequence:GTACCGGTGCCTCTTGGTGGCAGTATTCCTCGAGGAATACTGCCACCAAGAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031934.5-887s21c1
Sequence:GTACCGGACTTCGAGATGGAACGATTTGCTCGAGCAAATCGTTCCATCTCGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)