EMAIL THIS PAGE TO A FRIEND

RAB35

RAB35, member RAS oncogene family

145 Gene Product Result for
Synonyms: H-ray RAB1C RAY
UniProtKB ID: Q15286, B2R6E0, B4E390
Gene ID:
Mouse(77407) RAB35, member RAS oncogene family
Rat(288700) RAB35, member RAS oncogene family
fruit fly(33014) CG9575 gene product from transcript CG9575-RD
chicken(416983) RAB35, member RAS oncogene family
domestic cat(101080411) RAB35, member RAS oncogene family
dog(611477) RAB35, member RAS oncogene family
Zebrafish(445154) RAB35, member RAS oncogene family
naked mole-rat(101704071) RAB35, member RAS oncogene family
domestic guinea pig(100732151) RAB35, member RAS oncogene family
cow(614521) RAB35, member RAS oncogene family
sheep(101111230) RAB35, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108764 Anti-RAB35 affinity isolated antibody human, guinea pig, horse, pig, rat, bovine, mouse, zebrafish, canine, rabbit
western blot pricing
SAB2108765 Anti-RAB35 affinity isolated antibody bovine, pig, horse, guinea pig, yeast, canine, zebrafish, human, mouse, rabbit, rat
western blot pricing
SAB2105827 Anti-RAB35 antibody produced in rabbit affinity isolated antibody human, rabbit, horse, guinea pig
western blot pricing
SAB2105828 Anti-RAB35 antibody produced in rabbit affinity isolated antibody rabbit, horse, canine, guinea pig, bovine, yeast, rat, mouse, human, zebrafish
western blot pricing
SAB2701465 Anti-RAB35 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, hamster
immunofluorescence, immunohistochemistry, western blot pricing
HPA054146 Anti-RAB35 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006861 Rosetta Predictions human pricing
NM_001013046 Rosetta Predictions rat pricing
NM_198163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109978 predicted 484
2 SASI_Hs01_00109980 predicted 1013
3 SASI_Hs01_00109981 predicted 483
4 SASI_Hs02_00342479 predicted 1008
5 SASI_Hs01_00109982 predicted 416
6 SASI_Hs01_00109984 predicted 483
7 SASI_Hs01_00109985 predicted 1164
8 SASI_Hs01_00109986 predicted 351
9 SASI_Hs01_00109987 predicted 405
10 SASI_Hs02_00342480 predicted 1167
11 SASI_Hs01_00109979 predicted 355
12 SASI_Hs01_00109983 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113841 predicted 970
2 SASI_Rn01_00113842 predicted 502
3 SASI_Rn01_00113843 predicted 982
4 SASI_Rn01_00113844 predicted 427
5 SASI_Rn01_00113845 predicted 439
6 SASI_Rn01_00113846 predicted 977
7 SASI_Rn01_00113847 predicted 315
8 SASI_Rn01_00113848 predicted 374
9 SASI_Rn01_00113849 predicted 979
10 SASI_Rn01_00113850 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042814 predicted 691
2 SASI_Mm01_00042815 predicted 827
3 SASI_Mm01_00042816 predicted 498
4 SASI_Mm01_00042817 predicted 1164
5 SASI_Mm02_00350873 predicted 1006
6 SASI_Mm01_00042818 predicted 1034
7 SASI_Mm01_00042819 predicted 486
8 SASI_Mm01_00042820 predicted 447
9 SASI_Mm01_00042822 predicted 369
10 SASI_Mm01_00042823 predicted 438
11 SASI_Mm01_00042821 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006861
VALIDATED
RAB35 MISSION shRNA Bacterial Glycerol Stock
RAB35, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006861.4-451s1c1
Sequence:CCGGGCTTCACGAAATCAACCAGAACTCGAGTTCTGGTTGATTTCGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-486s1c1
Sequence:CCGGGCCGAATATTAGTGGGTAATACTCGAGTATTACCCACTAATATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-709s1c1
Sequence:CCGGGAAGCTCACGAAGAACAGTAACTCGAGTTACTGTTCTTCGTGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-207s1c1
Sequence:CCGGAGAGCAGTTTACTGTTGCGTTCTCGAGAACGCAACAGTAAACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006861.4-649s1c1
Sequence:CCGGCCTCCGAGCAAAGAAAGACAACTCGAGTTGTCTTTCTTTGCTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-475s21c1
Sequence:GTACCGGTGATGATGTGTGCCGAATATTCTCGAGAATATTCGGCACACATCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-207s21c1
Sequence:CCGGAGAGCAGTTTACTGTTGCGTTCTCGAGAACGCAACAGTAAACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-537s21c1
Sequence:CCGGAGACGGAAGATGCCTACAAATCTCGAGATTTGTAGGCATCTTCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-486s21c1
Sequence:CCGGGCCGAATATTAGTGGGTAATACTCGAGTATTACCCACTAATATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-359s21c1
Sequence:CCGGACCATCACCTCCACGTATTATCTCGAGATAATACGTGGAGGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-260s21c1
Sequence:CCGGACCACGATCGGAGTGGATTTCCTCGAGGAAATCCACTCCGATCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-565s21c1
Sequence:GTACCGGGCAGATGGGCATCCAGTTGTTCTCGAGAACAACTGGATGCCCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-601s21c1
Sequence:GTACCGGGGAGAATGTCAACGTGGAAGACTCGAGTCTTCCACGTTGACATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-453s21c1
Sequence:GTACCGGTTCACGAAATCAACCAGAACTCTCGAGAGTTCTGGTTGATTTCGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006861
VALIDATED
RAB35 MISSION shRNA shRNA Plasmid DNA
RAB35, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006861.4-451s1c1
Sequence:CCGGGCTTCACGAAATCAACCAGAACTCGAGTTCTGGTTGATTTCGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-486s1c1
Sequence:CCGGGCCGAATATTAGTGGGTAATACTCGAGTATTACCCACTAATATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-709s1c1
Sequence:CCGGGAAGCTCACGAAGAACAGTAACTCGAGTTACTGTTCTTCGTGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-207s1c1
Sequence:CCGGAGAGCAGTTTACTGTTGCGTTCTCGAGAACGCAACAGTAAACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006861.4-649s1c1
Sequence:CCGGCCTCCGAGCAAAGAAAGACAACTCGAGTTGTCTTTCTTTGCTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-475s21c1
Sequence:GTACCGGTGATGATGTGTGCCGAATATTCTCGAGAATATTCGGCACACATCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-207s21c1
Sequence:CCGGAGAGCAGTTTACTGTTGCGTTCTCGAGAACGCAACAGTAAACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-537s21c1
Sequence:CCGGAGACGGAAGATGCCTACAAATCTCGAGATTTGTAGGCATCTTCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-486s21c1
Sequence:CCGGGCCGAATATTAGTGGGTAATACTCGAGTATTACCCACTAATATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-359s21c1
Sequence:CCGGACCATCACCTCCACGTATTATCTCGAGATAATACGTGGAGGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-260s21c1
Sequence:CCGGACCACGATCGGAGTGGATTTCCTCGAGGAAATCCACTCCGATCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-565s21c1
Sequence:GTACCGGGCAGATGGGCATCCAGTTGTTCTCGAGAACAACTGGATGCCCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-601s21c1
Sequence:GTACCGGGGAGAATGTCAACGTGGAAGACTCGAGTCTTCCACGTTGACATTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-453s21c1
Sequence:GTACCGGTTCACGAAATCAACCAGAACTCTCGAGAGTTCTGGTTGATTTCGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006861
VALIDATED
RAB35 MISSION shRNA Lentiviral Transduction Particles
RAB35, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006861.4-451s1c1
Sequence:CCGGGCTTCACGAAATCAACCAGAACTCGAGTTCTGGTTGATTTCGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-486s1c1
Sequence:CCGGGCCGAATATTAGTGGGTAATACTCGAGTATTACCCACTAATATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-709s1c1
Sequence:CCGGGAAGCTCACGAAGAACAGTAACTCGAGTTACTGTTCTTCGTGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006861.4-207s1c1
Sequence:CCGGAGAGCAGTTTACTGTTGCGTTCTCGAGAACGCAACAGTAAACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006861.4-649s1c1
Sequence:CCGGCCTCCGAGCAAAGAAAGACAACTCGAGTTGTCTTTCTTTGCTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-475s21c1
Sequence:GTACCGGTGATGATGTGTGCCGAATATTCTCGAGAATATTCGGCACACATCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-207s21c1
Sequence:CCGGAGAGCAGTTTACTGTTGCGTTCTCGAGAACGCAACAGTAAACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-537s21c1
Sequence:CCGGAGACGGAAGATGCCTACAAATCTCGAGATTTGTAGGCATCTTCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-486s21c1
Sequence:CCGGGCCGAATATTAGTGGGTAATACTCGAGTATTACCCACTAATATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-359s21c1
Sequence:CCGGACCATCACCTCCACGTATTATCTCGAGATAATACGTGGAGGTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-260s21c1
Sequence:CCGGACCACGATCGGAGTGGATTTCCTCGAGGAAATCCACTCCGATCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006861.4-565s21c1
Sequence:GTACCGGGCAGATGGGCATCCAGTTGTTCTCGAGAACAACTGGATGCCCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-601s21c1
Sequence:GTACCGGGGAGAATGTCAACGTGGAAGACTCGAGTCTTCCACGTTGACATTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006861.4-453s21c1
Sequence:GTACCGGTTCACGAAATCAACCAGAACTCTCGAGAGTTCTGGTTGATTTCGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198163
VALIDATED
RAB35 MISSION shRNA Bacterial Glycerol Stock
RAB35, member RAS oncogene family
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-439s1c1
Sequence:CCGGCGAGTCCTTTGTCAACGTCAACTCGAGTTGACGTTGACAAAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198163.1-501s1c1
Sequence:CCGGGCCGAATATTAGTGGGCAATACTCGAGTATTGCCCACTAATATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-232s1c1
Sequence:CCGGGCTGTTACGATTCGCAGACAACTCGAGTTGTCTGCGAATCGTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-1998s1c1
Sequence:CCGGCGTAACTCAGAAGAACTGATTCTCGAGAATCAGTTCTTCTGAGTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-608s1c1
Sequence:CCGGAGTGCCAAGGAGAACGTCAATCTCGAGATTGACGTTCTCCTTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-836s21c1
Sequence:GTACCGGCTCAGTTTAGTGCCGTTATTTCTCGAGAAATAACGGCACTAAACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-457s21c1
Sequence:GTACCGGCAAGCGATGGCTTCATGAAATCTCGAGATTTCATGAAGCCATCGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-374s21c1
Sequence:GTACCGGACCATCACCTCTACGTATTATCTCGAGATAATACGTAGAGGTGATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-553s21c1
Sequence:GTACCGGGACAGAAGATGCCTACAAATTCTCGAGAATTTGTAGGCATCTTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198163
VALIDATED
RAB35 MISSION shRNA shRNA Plasmid DNA
RAB35, member RAS oncogene family
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-439s1c1
Sequence:CCGGCGAGTCCTTTGTCAACGTCAACTCGAGTTGACGTTGACAAAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198163.1-501s1c1
Sequence:CCGGGCCGAATATTAGTGGGCAATACTCGAGTATTGCCCACTAATATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-232s1c1
Sequence:CCGGGCTGTTACGATTCGCAGACAACTCGAGTTGTCTGCGAATCGTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-1998s1c1
Sequence:CCGGCGTAACTCAGAAGAACTGATTCTCGAGAATCAGTTCTTCTGAGTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-608s1c1
Sequence:CCGGAGTGCCAAGGAGAACGTCAATCTCGAGATTGACGTTCTCCTTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-836s21c1
Sequence:GTACCGGCTCAGTTTAGTGCCGTTATTTCTCGAGAAATAACGGCACTAAACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-457s21c1
Sequence:GTACCGGCAAGCGATGGCTTCATGAAATCTCGAGATTTCATGAAGCCATCGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-374s21c1
Sequence:GTACCGGACCATCACCTCTACGTATTATCTCGAGATAATACGTAGAGGTGATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-553s21c1
Sequence:GTACCGGGACAGAAGATGCCTACAAATTCTCGAGAATTTGTAGGCATCTTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198163
VALIDATED
RAB35 MISSION shRNA Lentiviral Transduction Particles
RAB35, member RAS oncogene family
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-439s1c1
Sequence:CCGGCGAGTCCTTTGTCAACGTCAACTCGAGTTGACGTTGACAAAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198163.1-501s1c1
Sequence:CCGGGCCGAATATTAGTGGGCAATACTCGAGTATTGCCCACTAATATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-232s1c1
Sequence:CCGGGCTGTTACGATTCGCAGACAACTCGAGTTGTCTGCGAATCGTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-1998s1c1
Sequence:CCGGCGTAACTCAGAAGAACTGATTCTCGAGAATCAGTTCTTCTGAGTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198163.1-608s1c1
Sequence:CCGGAGTGCCAAGGAGAACGTCAATCTCGAGATTGACGTTCTCCTTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-836s21c1
Sequence:GTACCGGCTCAGTTTAGTGCCGTTATTTCTCGAGAAATAACGGCACTAAACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-457s21c1
Sequence:GTACCGGCAAGCGATGGCTTCATGAAATCTCGAGATTTCATGAAGCCATCGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-374s21c1
Sequence:GTACCGGACCATCACCTCTACGTATTATCTCGAGATAATACGTAGAGGTGATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198163.1-553s21c1
Sequence:GTACCGGGACAGAAGATGCCTACAAATTCTCGAGAATTTGTAGGCATCTTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)