EMAIL THIS PAGE TO A FRIEND

RAB36

RAB36, member RAS oncogene family

45 Gene Product Result for
UniProtKB ID: O95755, Q2M390, Q7Z4A9, Q9UHP5
Gene ID:
Mouse(76877) RAB36, member RAS oncogene family
Rat(690407) RAB36, member RAS oncogene family
cow(518312) RAB36, member RAS oncogene family
domestic guinea pig(100728282) RAB36, member RAS oncogene family
naked mole-rat(101715179) RAB36, member RAS oncogene family
Zebrafish(780839) RAB36, member RAS oncogene family
chicken(416953) RAB36, member RAS oncogene family
domestic cat(101101419) RAB36, member RAS oncogene family
dog(607684) RAB36, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004914 Rosetta Predictions human pricing
NM_001109589 Rosetta Predictions rat pricing
NM_029781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218561 predicted 1134
2 SASI_Hs01_00218562 predicted 509
3 SASI_Hs01_00218563 predicted 839
4 SASI_Hs01_00218564 predicted 960
5 SASI_Hs01_00218565 predicted 282
6 SASI_Hs01_00218566 predicted 807
7 SASI_Hs01_00218567 predicted 262
8 SASI_Hs01_00218569 predicted 394
9 SASI_Hs02_00338578 predicted 1078
10 SASI_Hs01_00218570 predicted 773
11 SASI_Hs01_00218568 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249871 predicted 844
2 SASI_Rn02_00249872 predicted 785
3 SASI_Rn02_00249873 predicted 262
4 SASI_Rn02_00249874 predicted 348
5 SASI_Rn02_00249875 predicted 256
6 SASI_Rn02_00249876 predicted 537
7 SASI_Rn02_00249877 predicted 308
8 SASI_Rn02_00249878 predicted 270
9 SASI_Rn02_00249879 predicted 332
10 SASI_Rn02_00249880 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135372 predicted 533
2 SASI_Mm01_00135373 predicted 907
3 SASI_Mm01_00135374 predicted 452
4 SASI_Mm01_00135375 predicted 1101
5 SASI_Mm01_00135376 predicted 450
6 SASI_Mm01_00135377 predicted 536
7 SASI_Mm01_00135378 predicted 521
8 SASI_Mm01_00135380 predicted 1039
9 SASI_Mm01_00135381 predicted 1090
10 SASI_Mm02_00335927 predicted 903
11 SASI_Mm01_00135379 predicted 1255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004914
RAB36 MISSION shRNA Bacterial Glycerol Stock
RAB36, member RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-599s21c1
Sequence:GTACCGGTGCATCGCATCTGCCTACTACCTCGAGGTAGTAGGCAGATGCGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-737s21c1
Sequence:GTACCGGTTCCTCGTGGGAACCAAGAAGCTCGAGCTTCTTGGTTCCCACGAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004914.2-1289s21c1
Sequence:GTACCGGGCACTGTGGTGATCCCATAAACTCGAGTTTATGGGATCACCACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-516s21c1
Sequence:GTACCGGACTTTGAAATTGAGCGCTTTGCTCGAGCAAAGCGCTCAATTTCAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004914.2-1075s21c1
Sequence:GTACCGGCACACACACGGACAGGAATTTCTCGAGAAATTCCTGTCCGTGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-539s21c1
Sequence:GTACCGGATTGCTGGGATTCCCTATAGCCTCGAGGCTATAGGGAATCCCAGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-530s1c1
Sequence:CCGGCGCTTTGAGATTGCTGGGATTCTCGAGAATCCCAGCAATCTCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-302s1c1
Sequence:CCGGCCTAAGTGGTACACGCCGGAACTCGAGTTCCGGCGTGTACCACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-773s1c1
Sequence:CCGGGCCGCATGTGAGCAGGCCGAACTCGAGTTCGGCCTGCTCACATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-954s1c1
Sequence:CCGGAGGTCGGCAATGGAGACCTAACTCGAGTTAGGTCTCCATTGCCGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-628s1c1
Sequence:CCGGCCAGGTGATCATCACGGCCTTCTCGAGAAGGCCGTGATGATCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004914
RAB36 MISSION shRNA shRNA Plasmid DNA
RAB36, member RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-599s21c1
Sequence:GTACCGGTGCATCGCATCTGCCTACTACCTCGAGGTAGTAGGCAGATGCGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-737s21c1
Sequence:GTACCGGTTCCTCGTGGGAACCAAGAAGCTCGAGCTTCTTGGTTCCCACGAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004914.2-1289s21c1
Sequence:GTACCGGGCACTGTGGTGATCCCATAAACTCGAGTTTATGGGATCACCACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-516s21c1
Sequence:GTACCGGACTTTGAAATTGAGCGCTTTGCTCGAGCAAAGCGCTCAATTTCAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004914.2-1075s21c1
Sequence:GTACCGGCACACACACGGACAGGAATTTCTCGAGAAATTCCTGTCCGTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-539s21c1
Sequence:GTACCGGATTGCTGGGATTCCCTATAGCCTCGAGGCTATAGGGAATCCCAGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-530s1c1
Sequence:CCGGCGCTTTGAGATTGCTGGGATTCTCGAGAATCCCAGCAATCTCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-302s1c1
Sequence:CCGGCCTAAGTGGTACACGCCGGAACTCGAGTTCCGGCGTGTACCACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-773s1c1
Sequence:CCGGGCCGCATGTGAGCAGGCCGAACTCGAGTTCGGCCTGCTCACATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-954s1c1
Sequence:CCGGAGGTCGGCAATGGAGACCTAACTCGAGTTAGGTCTCCATTGCCGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-628s1c1
Sequence:CCGGCCAGGTGATCATCACGGCCTTCTCGAGAAGGCCGTGATGATCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004914
RAB36 MISSION shRNA Lentiviral Transduction Particles
RAB36, member RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-599s21c1
Sequence:GTACCGGTGCATCGCATCTGCCTACTACCTCGAGGTAGTAGGCAGATGCGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-737s21c1
Sequence:GTACCGGTTCCTCGTGGGAACCAAGAAGCTCGAGCTTCTTGGTTCCCACGAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004914.2-1289s21c1
Sequence:GTACCGGGCACTGTGGTGATCCCATAAACTCGAGTTTATGGGATCACCACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-516s21c1
Sequence:GTACCGGACTTTGAAATTGAGCGCTTTGCTCGAGCAAAGCGCTCAATTTCAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004914.2-1075s21c1
Sequence:GTACCGGCACACACACGGACAGGAATTTCTCGAGAAATTCCTGTCCGTGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004914.2-539s21c1
Sequence:GTACCGGATTGCTGGGATTCCCTATAGCCTCGAGGCTATAGGGAATCCCAGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-530s1c1
Sequence:CCGGCGCTTTGAGATTGCTGGGATTCTCGAGAATCCCAGCAATCTCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-302s1c1
Sequence:CCGGCCTAAGTGGTACACGCCGGAACTCGAGTTCCGGCGTGTACCACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-773s1c1
Sequence:CCGGGCCGCATGTGAGCAGGCCGAACTCGAGTTCGGCCTGCTCACATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-954s1c1
Sequence:CCGGAGGTCGGCAATGGAGACCTAACTCGAGTTAGGTCTCCATTGCCGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004914.2-628s1c1
Sequence:CCGGCCAGGTGATCATCACGGCCTTCTCGAGAAGGCCGTGATGATCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029781
RAB36 MISSION shRNA Bacterial Glycerol Stock
RAB36, member RAS oncogene family
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1248s21c1
Sequence:GTACCGGAGATGGTTGTTGTGTTCTTAACTCGAGTTAAGAACACAACAACCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1410s21c1
Sequence:GTACCGGTTGTCAGAGGAAGCGAGTAAACTCGAGTTTACTCGCTTCCTCTGACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1537s21c1
Sequence:GTACCGGTGCTAAGCACAATGGACAAAGCTCGAGCTTTGTCCATTGTGCTTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029781.1-2030s1c1
Sequence:CCGGCCCATCTTTCTCCTGCCATAACTCGAGTTATGGCAGGAGAAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-495s1c1
Sequence:CCGGCCATGATTACAAGGCCACGATCTCGAGATCGTGGCCTTGTAATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-462s1c1
Sequence:CCGGCCTCATTCACAGGTTGTGCAACTCGAGTTGCACAACCTGTGAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-603s1c1
Sequence:CCGGCAAGTGTATTGCGTCTGCCTACTCGAGTAGGCAGACGCAATACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-976s1c1
Sequence:CCGGGATGGAGACCTAATACGAATACTCGAGTATTCGTATTAGGTCTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029781
RAB36 MISSION shRNA shRNA Plasmid DNA
RAB36, member RAS oncogene family
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1248s21c1
Sequence:GTACCGGAGATGGTTGTTGTGTTCTTAACTCGAGTTAAGAACACAACAACCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1410s21c1
Sequence:GTACCGGTTGTCAGAGGAAGCGAGTAAACTCGAGTTTACTCGCTTCCTCTGACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1537s21c1
Sequence:GTACCGGTGCTAAGCACAATGGACAAAGCTCGAGCTTTGTCCATTGTGCTTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029781.1-2030s1c1
Sequence:CCGGCCCATCTTTCTCCTGCCATAACTCGAGTTATGGCAGGAGAAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-495s1c1
Sequence:CCGGCCATGATTACAAGGCCACGATCTCGAGATCGTGGCCTTGTAATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-462s1c1
Sequence:CCGGCCTCATTCACAGGTTGTGCAACTCGAGTTGCACAACCTGTGAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-603s1c1
Sequence:CCGGCAAGTGTATTGCGTCTGCCTACTCGAGTAGGCAGACGCAATACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-976s1c1
Sequence:CCGGGATGGAGACCTAATACGAATACTCGAGTATTCGTATTAGGTCTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029781
RAB36 MISSION shRNA Lentiviral Transduction Particles
RAB36, member RAS oncogene family
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1248s21c1
Sequence:GTACCGGAGATGGTTGTTGTGTTCTTAACTCGAGTTAAGAACACAACAACCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1410s21c1
Sequence:GTACCGGTTGTCAGAGGAAGCGAGTAAACTCGAGTTTACTCGCTTCCTCTGACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029781.3-1537s21c1
Sequence:GTACCGGTGCTAAGCACAATGGACAAAGCTCGAGCTTTGTCCATTGTGCTTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029781.1-2030s1c1
Sequence:CCGGCCCATCTTTCTCCTGCCATAACTCGAGTTATGGCAGGAGAAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-495s1c1
Sequence:CCGGCCATGATTACAAGGCCACGATCTCGAGATCGTGGCCTTGTAATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-462s1c1
Sequence:CCGGCCTCATTCACAGGTTGTGCAACTCGAGTTGCACAACCTGTGAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-603s1c1
Sequence:CCGGCAAGTGTATTGCGTCTGCCTACTCGAGTAGGCAGACGCAATACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029781.1-976s1c1
Sequence:CCGGGATGGAGACCTAATACGAATACTCGAGTATTCGTATTAGGTCTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)