EMAIL THIS PAGE TO A FRIEND

RAB38

RAB38, member RAS oncogene family

125 Gene Product Result for
Synonyms: NY-MEL-1 rrGTPbp
UniProtKB ID: P57729, Q53XK7
Gene ID:
Mouse(72433) RAB38, member of RAS oncogene family
Rat(252916) RAB38, member RAS oncogene family
cow(533332) RAB38, member RAS oncogene family
sheep(101122822) RAB38, member RAS oncogene family
domestic guinea pig(100714663) RAB38, member RAS oncogene family
naked mole-rat(101699100) RAB38, member RAS oncogene family
chicken(428095) RAB38, member RAS oncogene family
dog(608181) RAB38, member RAS oncogene family
domestic cat(101092787) RAB38, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022337 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022337 Rosetta Predictions human pricing
NM_145774 Rosetta Predictions rat pricing
NM_028238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247036 predicted 750
2 SASI_Hs01_00247037 predicted 726
3 SASI_Hs01_00247038 predicted 359
4 SASI_Hs01_00247039 predicted 259
5 SASI_Hs02_00355619 predicted 293
6 SASI_Hs01_00247040 predicted 288
7 SASI_Hs01_00247041 predicted 300
8 SASI_Hs01_00247042 predicted 751
9 SASI_Hs01_00247043 predicted 597
10 SASI_Hs01_00247045 predicted 573
11 SASI_Hs01_00247044 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104337 predicted 331
2 SASI_Rn01_00104338 predicted 805
3 SASI_Rn01_00104339 predicted 364
4 SASI_Rn01_00104341 predicted 604
5 SASI_Rn01_00104342 predicted 464
6 SASI_Rn01_00104343 predicted 784
7 SASI_Rn02_00268774 predicted 726
8 SASI_Rn01_00104345 predicted 258
9 SASI_Rn01_00104346 predicted 568
10 SASI_Rn02_00268775 predicted 284
11 SASI_Rn01_00104340 predicted 960
12 SASI_Rn01_00104344 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064134 predicted 676
2 SASI_Mm02_00333586 predicted 647
3 SASI_Mm01_00064136 predicted 541
4 SASI_Mm01_00064137 predicted 802
5 SASI_Mm01_00064138 predicted 882
6 SASI_Mm01_00064139 predicted 339
7 SASI_Mm01_00064140 predicted 316
8 SASI_Mm01_00064141 predicted 407
9 SASI_Mm01_00064142 predicted 873
10 SASI_Mm01_00064143 predicted 447
11 SASI_Mm01_00064135 predicted 923
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028238
VALIDATED
RAB38 MISSION shRNA Bacterial Glycerol Stock
RAB38, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028238.5-1043s1c1
Sequence:CCGGGCCCTAATATTTGTTCCTTTACTCGAGTAAAGGAACAAATATTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-582s1c1
Sequence:CCGGGCTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-686s21c1
Sequence:GTACCGGAGTCTATAGAACCGGACATTGCTCGAGCAATGTCCGGTTCTATAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028238.7-1031s21c1
Sequence:GTACCGGGGACACAGACAGCCCTAATATCTCGAGATATTAGGGCTGTCTGTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-345s21c1
Sequence:GTACCGGTGGAAACATGACAAGAGTTTACTCGAGTAAACTCTTGTCATGTTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-197s1c1
Sequence:CCGGACCAGCATTATCAAGCGCTATCTCGAGATAGCGCTTGATAATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028238.5-418s1c1
Sequence:CCGGCACATTTGAAGCCGTGGCAAACTCGAGTTTGCCACGGCTTCAAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-686s1c1
Sequence:CCGGGAGTCTATAGAACCGGACATTCTCGAGAATGTCCGGTTCTATAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028238.7-1186s21c1
Sequence:GTACCGGTGGTCTGATAGGTCTATTAAACTCGAGTTTAATAGACCTATCAGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-527s21c1
Sequence:GTACCGGAGGATGTGCTTATGAACAATGCTCGAGCATTGTTCATAAGCACATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028238
VALIDATED
RAB38 MISSION shRNA shRNA Plasmid DNA
RAB38, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028238.5-1043s1c1
Sequence:CCGGGCCCTAATATTTGTTCCTTTACTCGAGTAAAGGAACAAATATTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-582s1c1
Sequence:CCGGGCTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-686s21c1
Sequence:GTACCGGAGTCTATAGAACCGGACATTGCTCGAGCAATGTCCGGTTCTATAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028238.7-1031s21c1
Sequence:GTACCGGGGACACAGACAGCCCTAATATCTCGAGATATTAGGGCTGTCTGTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-345s21c1
Sequence:GTACCGGTGGAAACATGACAAGAGTTTACTCGAGTAAACTCTTGTCATGTTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-197s1c1
Sequence:CCGGACCAGCATTATCAAGCGCTATCTCGAGATAGCGCTTGATAATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028238.5-418s1c1
Sequence:CCGGCACATTTGAAGCCGTGGCAAACTCGAGTTTGCCACGGCTTCAAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-686s1c1
Sequence:CCGGGAGTCTATAGAACCGGACATTCTCGAGAATGTCCGGTTCTATAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028238.7-1186s21c1
Sequence:GTACCGGTGGTCTGATAGGTCTATTAAACTCGAGTTTAATAGACCTATCAGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-527s21c1
Sequence:GTACCGGAGGATGTGCTTATGAACAATGCTCGAGCATTGTTCATAAGCACATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028238
VALIDATED
RAB38 MISSION shRNA Lentiviral Transduction Particles
RAB38, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028238.5-1043s1c1
Sequence:CCGGGCCCTAATATTTGTTCCTTTACTCGAGTAAAGGAACAAATATTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-582s1c1
Sequence:CCGGGCTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-686s21c1
Sequence:GTACCGGAGTCTATAGAACCGGACATTGCTCGAGCAATGTCCGGTTCTATAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028238.7-1031s21c1
Sequence:GTACCGGGGACACAGACAGCCCTAATATCTCGAGATATTAGGGCTGTCTGTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-345s21c1
Sequence:GTACCGGTGGAAACATGACAAGAGTTTACTCGAGTAAACTCTTGTCATGTTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-197s1c1
Sequence:CCGGACCAGCATTATCAAGCGCTATCTCGAGATAGCGCTTGATAATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028238.5-418s1c1
Sequence:CCGGCACATTTGAAGCCGTGGCAAACTCGAGTTTGCCACGGCTTCAAATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028238.5-686s1c1
Sequence:CCGGGAGTCTATAGAACCGGACATTCTCGAGAATGTCCGGTTCTATAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028238.7-1186s21c1
Sequence:GTACCGGTGGTCTGATAGGTCTATTAAACTCGAGTTTAATAGACCTATCAGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028238.7-527s21c1
Sequence:GTACCGGAGGATGTGCTTATGAACAATGCTCGAGCATTGTTCATAAGCACATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022337
VALIDATED
RAB38 MISSION shRNA Bacterial Glycerol Stock
RAB38, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-288s1c1
Sequence:CCGGCGAGAAGCTATGGGTGCATTTCTCGAGAAATGCACCCATAGCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-581s1c1
Sequence:CCGGTGCAAATGAGTGTGACCTAATCTCGAGATTAGGTCACACTCATTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022337.1-499s1c1
Sequence:CCGGGTTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-452s1c1
Sequence:CCGGGCTCATGAACAATGGCCTCAACTCGAGTTGAGGCCATTGTTCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-397s1c1
Sequence:CCGGGCAAACCGGTTTCAGTGGTTTCTCGAGAAACCACTGAAACCGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-239s21c1
Sequence:GTACCGGGGATATCGCAGGTCAAGAAAGCTCGAGCTTTCTTGACCTGCGATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-591s21c1
Sequence:GTACCGGTGTGACCTAATGGAGTCTATTCTCGAGAATAGACTCCATTAGGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-452s21c1
Sequence:CCGGGCTCATGAACAATGGCCTCAACTCGAGTTGAGGCCATTGTTCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-265s21c1
Sequence:CCGGGAAACATGACGAGGGTCTATTCTCGAGAATAGACCCTCGTCATGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022337.1-1094s21c1
Sequence:CCGGATGGCCTGACAGGCCTATTAACTCGAGTTAATAGGCCTGTCAGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-365s21c1
Sequence:CCGGTGATTTGGACTCCAAGTTAAGCTCGAGCTTAACTTGGAGTCCAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-499s21c1
Sequence:CCGGGTTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-389s21c1
Sequence:GTACCGGCCCTAATGGCAAACCGGTTTCCTCGAGGAAACCGGTTTGCCATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022337.1-759s21c1
Sequence:GTACCGGGTAAACGTCAGGATAGATATACTCGAGTATATCTATCCTGACGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022337
VALIDATED
RAB38 MISSION shRNA shRNA Plasmid DNA
RAB38, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-288s1c1
Sequence:CCGGCGAGAAGCTATGGGTGCATTTCTCGAGAAATGCACCCATAGCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-581s1c1
Sequence:CCGGTGCAAATGAGTGTGACCTAATCTCGAGATTAGGTCACACTCATTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022337.1-499s1c1
Sequence:CCGGGTTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-452s1c1
Sequence:CCGGGCTCATGAACAATGGCCTCAACTCGAGTTGAGGCCATTGTTCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-397s1c1
Sequence:CCGGGCAAACCGGTTTCAGTGGTTTCTCGAGAAACCACTGAAACCGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-239s21c1
Sequence:GTACCGGGGATATCGCAGGTCAAGAAAGCTCGAGCTTTCTTGACCTGCGATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-591s21c1
Sequence:GTACCGGTGTGACCTAATGGAGTCTATTCTCGAGAATAGACTCCATTAGGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-452s21c1
Sequence:CCGGGCTCATGAACAATGGCCTCAACTCGAGTTGAGGCCATTGTTCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-265s21c1
Sequence:CCGGGAAACATGACGAGGGTCTATTCTCGAGAATAGACCCTCGTCATGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022337.1-1094s21c1
Sequence:CCGGATGGCCTGACAGGCCTATTAACTCGAGTTAATAGGCCTGTCAGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-365s21c1
Sequence:CCGGTGATTTGGACTCCAAGTTAAGCTCGAGCTTAACTTGGAGTCCAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-499s21c1
Sequence:CCGGGTTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-389s21c1
Sequence:GTACCGGCCCTAATGGCAAACCGGTTTCCTCGAGGAAACCGGTTTGCCATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022337.1-759s21c1
Sequence:GTACCGGGTAAACGTCAGGATAGATATACTCGAGTATATCTATCCTGACGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022337
VALIDATED
RAB38 MISSION shRNA Lentiviral Transduction Particles
RAB38, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-288s1c1
Sequence:CCGGCGAGAAGCTATGGGTGCATTTCTCGAGAAATGCACCCATAGCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-581s1c1
Sequence:CCGGTGCAAATGAGTGTGACCTAATCTCGAGATTAGGTCACACTCATTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022337.1-499s1c1
Sequence:CCGGGTTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-452s1c1
Sequence:CCGGGCTCATGAACAATGGCCTCAACTCGAGTTGAGGCCATTGTTCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_022337.1-397s1c1
Sequence:CCGGGCAAACCGGTTTCAGTGGTTTCTCGAGAAACCACTGAAACCGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-239s21c1
Sequence:GTACCGGGGATATCGCAGGTCAAGAAAGCTCGAGCTTTCTTGACCTGCGATATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-591s21c1
Sequence:GTACCGGTGTGACCTAATGGAGTCTATTCTCGAGAATAGACTCCATTAGGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-452s21c1
Sequence:CCGGGCTCATGAACAATGGCCTCAACTCGAGTTGAGGCCATTGTTCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-265s21c1
Sequence:CCGGGAAACATGACGAGGGTCTATTCTCGAGAATAGACCCTCGTCATGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022337.1-1094s21c1
Sequence:CCGGATGGCCTGACAGGCCTATTAACTCGAGTTAATAGGCCTGTCAGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-365s21c1
Sequence:CCGGTGATTTGGACTCCAAGTTAAGCTCGAGCTTAACTTGGAGTCCAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-499s21c1
Sequence:CCGGGTTTCGTAGGATGGTTTGAAACTCGAGTTTCAAACCATCCTACGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022337.1-389s21c1
Sequence:GTACCGGCCCTAATGGCAAACCGGTTTCCTCGAGGAAACCGGTTTGCCATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022337.1-759s21c1
Sequence:GTACCGGGTAAACGTCAGGATAGATATACTCGAGTATATCTATCCTGACGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)