EMAIL THIS PAGE TO A FRIEND

RAB39B

RAB39B, member RAS oncogene family

91 Gene Product Result for
Synonyms: MRX72
UniProtKB ID: Q96DA2, Q5JT79, Q8NEX3
Gene ID:
Human(116442) Summary: This gene encodes a member of the Rab family of proteins. Rab proteins are small GTPases that are involved in vesicular trafficking. [provided by RefSeq, Jul 2008]
Mouse(67790) RAB39B, member RAS oncogene family
Zebrafish(566010) RAB39B, member RAS oncogene family
domestic cat(101097054) RAB39B, member RAS oncogene family
dog(100684215) RAB39B, member RAS oncogene family
chicken(422354) RAB39B, member RAS oncogene family
domestic guinea pig(100719178) RAB39B, member RAS oncogene family
naked mole-rat(101718145) RAB39B, member RAS oncogene family
Domestic Rabbit(100328771) RAB39B, member RAS oncogene family
cow(537560) RAB39B, member RAS oncogene family
sheep(101105306) RAB39B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_171998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_171998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_171998 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_171998 Rosetta Predictions human pricing
NM_175122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058671 predicted 779
2 SASI_Hs01_00058672 predicted 565
3 SASI_Hs02_00367758 predicted 978
4 SASI_Hs01_00058673 predicted 583
5 SASI_Hs01_00058674 predicted 783
6 SASI_Hs01_00058675 predicted 875
7 SASI_Hs01_00058676 predicted 858
8 SASI_Hs01_00058677 predicted 507
9 SASI_Hs01_00058678 predicted 905
10 SASI_Hs01_00058679 predicted 702
11 SASI_Hs01_00058680 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104239 predicted 699
2 SASI_Mm01_00104241 predicted 227
3 SASI_Mm02_00345733 predicted 797
4 SASI_Mm01_00104242 predicted 819
5 SASI_Mm01_00104243 predicted 825
6 SASI_Mm01_00104245 predicted 925
7 SASI_Mm01_00104246 predicted 419
8 SASI_Mm01_00104247 predicted 775
9 SASI_Mm01_00104248 predicted 934
10 SASI_Mm02_00345734 predicted 604
11 SASI_Mm01_00104240 predicted 496
12 SASI_Mm01_00104244 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_171998
VALIDATED
RAB39B MISSION shRNA Bacterial Glycerol Stock
RAB39B, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-468s1c1
Sequence:CCGGGAGTGGTTAGAAGAGACCAAACTCGAGTTTGGTCTCTTCTAACCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-393s1c1
Sequence:CCGGGCCTACTACAGGAACTCAGTACTCGAGTACTGAGTTCCTGTAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-594s1c1
Sequence:CCGGGCATACGGCATGAAGTACATTCTCGAGAATGTACTTCATGCCGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-498s1c1
Sequence:CCGGCAGCCCTACCAAATTGTATTTCTCGAGAAATACAATTTGGTAGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171998.1-731s1c1
Sequence:CCGGGAAGAGTGGATTTGTACCAAACTCGAGTTTGGTACAAATCCACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-527s21c1
Sequence:GTACCGGTAGGTGGTCTTCTCTTATTTGCTCGAGCAAATAAGAGAAGACCACCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_171998.2-1841s21c1
Sequence:CCGGAGTTACTTGGGCTACTTATTTCTCGAGAAATAAGTAGCCCAAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-775s21c1
Sequence:CCGGGACCTGACAAGAGACATATATCTCGAGATATATGTCTCTTGTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-736s21c1
Sequence:CCGGTCAGCCCGAGATGCCATTAATCTCGAGATTAATGGCATCTCGGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-606s21c1
Sequence:CCGGACACGTTCAGCCCTACCAAATCTCGAGATTTGGTAGGGCTGAACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_171998
VALIDATED
RAB39B MISSION shRNA shRNA Plasmid DNA
RAB39B, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-468s1c1
Sequence:CCGGGAGTGGTTAGAAGAGACCAAACTCGAGTTTGGTCTCTTCTAACCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-393s1c1
Sequence:CCGGGCCTACTACAGGAACTCAGTACTCGAGTACTGAGTTCCTGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-594s1c1
Sequence:CCGGGCATACGGCATGAAGTACATTCTCGAGAATGTACTTCATGCCGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-498s1c1
Sequence:CCGGCAGCCCTACCAAATTGTATTTCTCGAGAAATACAATTTGGTAGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171998.1-731s1c1
Sequence:CCGGGAAGAGTGGATTTGTACCAAACTCGAGTTTGGTACAAATCCACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-527s21c1
Sequence:GTACCGGTAGGTGGTCTTCTCTTATTTGCTCGAGCAAATAAGAGAAGACCACCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_171998.2-1841s21c1
Sequence:CCGGAGTTACTTGGGCTACTTATTTCTCGAGAAATAAGTAGCCCAAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-775s21c1
Sequence:CCGGGACCTGACAAGAGACATATATCTCGAGATATATGTCTCTTGTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-736s21c1
Sequence:CCGGTCAGCCCGAGATGCCATTAATCTCGAGATTAATGGCATCTCGGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-606s21c1
Sequence:CCGGACACGTTCAGCCCTACCAAATCTCGAGATTTGGTAGGGCTGAACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_171998
VALIDATED
RAB39B MISSION shRNA Lentiviral Transduction Particles
RAB39B, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-468s1c1
Sequence:CCGGGAGTGGTTAGAAGAGACCAAACTCGAGTTTGGTCTCTTCTAACCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-393s1c1
Sequence:CCGGGCCTACTACAGGAACTCAGTACTCGAGTACTGAGTTCCTGTAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-594s1c1
Sequence:CCGGGCATACGGCATGAAGTACATTCTCGAGAATGTACTTCATGCCGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_171998.1-498s1c1
Sequence:CCGGCAGCCCTACCAAATTGTATTTCTCGAGAAATACAATTTGGTAGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171998.1-731s1c1
Sequence:CCGGGAAGAGTGGATTTGTACCAAACTCGAGTTTGGTACAAATCCACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-527s21c1
Sequence:GTACCGGTAGGTGGTCTTCTCTTATTTGCTCGAGCAAATAAGAGAAGACCACCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_171998.2-1841s21c1
Sequence:CCGGAGTTACTTGGGCTACTTATTTCTCGAGAAATAAGTAGCCCAAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-775s21c1
Sequence:CCGGGACCTGACAAGAGACATATATCTCGAGATATATGTCTCTTGTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-736s21c1
Sequence:CCGGTCAGCCCGAGATGCCATTAATCTCGAGATTAATGGCATCTCGGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_171998.2-606s21c1
Sequence:CCGGACACGTTCAGCCCTACCAAATCTCGAGATTTGGTAGGGCTGAACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175122
RAB39B MISSION shRNA Bacterial Glycerol Stock
RAB39B, member RAS oncogene family
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175122.2-2832s1c1
Sequence:CCGGCCCAGGATTATCCAGTGGATACTCGAGTATCCACTGGATAATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-427s1c1
Sequence:CCGGGCCTACTACAGGAATTCAGTACTCGAGTACTGAATTCCTGTAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-292s1c1
Sequence:CCGGCGCTTTGCTCAGGTTTCAGATCTCGAGATCTGAAACCTGAGCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-226s1c1
Sequence:CCGGCGGCTCATTGTCATCGGCGATCTCGAGATCGCCGATGACAATGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-535s1c1
Sequence:CCGGCCCTACCAAATTGTATTTGTTCTCGAGAACAAATACAATTTGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175122.5-1094s21c1
Sequence:GTACCGGGCCCTTTGTGGACCACATATTCTCGAGAATATGTGGTCCACAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175122.5-824s21c1
Sequence:GTACCGGGAGATGTTTGTGCTAGTTAACCTCGAGGTTAACTAGCACAAACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175122.5-524s21c1
Sequence:GTACCGGACACGTTCAGCCCTACCAAATCTCGAGATTTGGTAGGGCTGAACGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175122.5-863s21c1
Sequence:GTACCGGTACTCTCCCACTTGAACTTAACTCGAGTTAAGTTCAAGTGGGAGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175122
RAB39B MISSION shRNA shRNA Plasmid DNA
RAB39B, member RAS oncogene family
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175122.2-2832s1c1
Sequence:CCGGCCCAGGATTATCCAGTGGATACTCGAGTATCCACTGGATAATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-427s1c1
Sequence:CCGGGCCTACTACAGGAATTCAGTACTCGAGTACTGAATTCCTGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-292s1c1
Sequence:CCGGCGCTTTGCTCAGGTTTCAGATCTCGAGATCTGAAACCTGAGCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-226s1c1
Sequence:CCGGCGGCTCATTGTCATCGGCGATCTCGAGATCGCCGATGACAATGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-535s1c1
Sequence:CCGGCCCTACCAAATTGTATTTGTTCTCGAGAACAAATACAATTTGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175122.5-1094s21c1
Sequence:GTACCGGGCCCTTTGTGGACCACATATTCTCGAGAATATGTGGTCCACAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175122.5-824s21c1
Sequence:GTACCGGGAGATGTTTGTGCTAGTTAACCTCGAGGTTAACTAGCACAAACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175122.5-524s21c1
Sequence:GTACCGGACACGTTCAGCCCTACCAAATCTCGAGATTTGGTAGGGCTGAACGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175122.5-863s21c1
Sequence:GTACCGGTACTCTCCCACTTGAACTTAACTCGAGTTAAGTTCAAGTGGGAGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175122
RAB39B MISSION shRNA Lentiviral Transduction Particles
RAB39B, member RAS oncogene family
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175122.2-2832s1c1
Sequence:CCGGCCCAGGATTATCCAGTGGATACTCGAGTATCCACTGGATAATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-427s1c1
Sequence:CCGGGCCTACTACAGGAATTCAGTACTCGAGTACTGAATTCCTGTAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-292s1c1
Sequence:CCGGCGCTTTGCTCAGGTTTCAGATCTCGAGATCTGAAACCTGAGCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-226s1c1
Sequence:CCGGCGGCTCATTGTCATCGGCGATCTCGAGATCGCCGATGACAATGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175122.2-535s1c1
Sequence:CCGGCCCTACCAAATTGTATTTGTTCTCGAGAACAAATACAATTTGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175122.5-1094s21c1
Sequence:GTACCGGGCCCTTTGTGGACCACATATTCTCGAGAATATGTGGTCCACAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175122.5-824s21c1
Sequence:GTACCGGGAGATGTTTGTGCTAGTTAACCTCGAGGTTAACTAGCACAAACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175122.5-524s21c1
Sequence:GTACCGGACACGTTCAGCCCTACCAAATCTCGAGATTTGGTAGGGCTGAACGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175122.5-863s21c1
Sequence:GTACCGGTACTCTCCCACTTGAACTTAACTCGAGTTAAGTTCAAGTGGGAGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)