EMAIL THIS PAGE TO A FRIEND

RAB3A

RAB3A, member RAS oncogene family

60 Gene Product Result for
UniProtKB ID: P20336, A8K0J4, Q9NYE1
Gene ID:
Mouse(19339) RAB3A, member RAS oncogene family
Rat(25531) RAB3A, member RAS oncogene family
cow(282029) RAB3A, member RAS oncogene family
sheep(100147793) RAB3A, member RAS oncogene family
sheep(101109534) RAB3A, member RAS oncogene family
naked mole-rat(101720450) RAB3A, member RAS oncogene family
domestic guinea pig(100379151) RAB3A, member RAS oncogene family
dog(484826) RAB3A, member RAS oncogene family
domestic cat(101085865) RAB3A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002866 Rosetta Predictions human pricing
NM_013018 Rosetta Predictions rat pricing
NM_009001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148585 predicted 416
2 SASI_Hs01_00148586 predicted 411
3 SASI_Hs01_00148587 predicted 594
4 SASI_Hs01_00148588 predicted 250
5 SASI_Hs01_00148589 predicted 594
6 SASI_Hs01_00148590 predicted 454
7 SASI_Hs01_00148591 predicted 607
8 SASI_Hs01_00148592 predicted 386
9 SASI_Hs01_00148593 predicted 313
10 SASI_Hs01_00148594 predicted 145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059090 predicted 274
2 SASI_Rn01_00059092 predicted 532
3 SASI_Rn01_00059093 predicted 340
4 SASI_Rn01_00059094 predicted 425
5 SASI_Rn01_00059095 predicted 662
6 SASI_Rn02_00260691 predicted 650
7 SASI_Rn01_00059096 predicted 605
8 SASI_Rn02_00260692 predicted 629
9 SASI_Rn02_00260693 predicted 629
10 SASI_Rn01_00059097 predicted 422
11 SASI_Rn01_00059089 predicted 295
12 SASI_Rn01_00059091 predicted 651
13 SASI_Rn01_00059098 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078143 predicted 992
2 SASI_Mm02_00315123 predicted 624
3 SASI_Mm01_00078144 predicted 685
4 SASI_Mm01_00078145 predicted 531
5 SASI_Mm01_00078146 predicted 876
6 SASI_Mm01_00078147 predicted 509
7 SASI_Mm01_00078148 predicted 1050
8 SASI_Mm01_00078150 predicted 835
9 SASI_Mm01_00078151 predicted 445
10 SASI_Mm02_00315124 predicted 354
11 SASI_Mm01_00078149 predicted 259
12 SASI_Mm01_00078152 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002866
VALIDATED
RAB3A MISSION shRNA Bacterial Glycerol Stock
RAB3A, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-345s21c1
Sequence:GTACCGGTCAAGGTCAAGACCATCTATCCTCGAGGATAGATGGTCTTGACCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-722s21c1
Sequence:GTACCGGGAGAAGATGTCCGAGTCGTTGCTCGAGCAACGACTCGGACATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-266s1c1
Sequence:CCGGCGACTCGTTCACGCCTGCCTTCTCGAGAAGGCAGGCGTGAACGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-424s21c1
Sequence:GTACCGGGACCATCACCACCGCATACTACTCGAGTAGTATGCGGTGGTGATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002866.3-194s1c1
Sequence:CCGGCTACATGTTCAAGATTCTCATCTCGAGATGAGAATCTTGAACATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-447s1c1
Sequence:CCGGACCAACGAGGAATCCTTCAATCTCGAGATTGAAGGATTCCTCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002866.3-320s1c1
Sequence:CCGGGACCATCTATCGCAACGACAACTCGAGTTGTCGTTGCGATAGATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-686s1c1
Sequence:CCGGCGAGAAGATGTCCGAGTCGTTCTCGAGAACGACTCGGACATCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-513s21c1
Sequence:GTACCGGACTGGTCCACCCAGATCAAGACTCGAGTCTTGATCTGGGTGGACCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-202s21c1
Sequence:GTACCGGGAAGGAGTCCTCGGATCAGAACTCGAGTTCTGATCCGAGGACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-367s21c1
Sequence:GTACCGGCAACGACAAGAGGATCAAGCTCTCGAGAGCTTGATCCTCTTGTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-556s21c1
Sequence:GTACCGGGGTGCTGCTGGTAGGAAACAACTCGAGTTGTTTCCTACCAGCAGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-631s21c1
Sequence:GTACCGGTGACCACCTTGGGTTCGAGTTCTCGAGAACTCGAACCCAAGGTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002866
VALIDATED
RAB3A MISSION shRNA shRNA Plasmid DNA
RAB3A, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-345s21c1
Sequence:GTACCGGTCAAGGTCAAGACCATCTATCCTCGAGGATAGATGGTCTTGACCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-722s21c1
Sequence:GTACCGGGAGAAGATGTCCGAGTCGTTGCTCGAGCAACGACTCGGACATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-266s1c1
Sequence:CCGGCGACTCGTTCACGCCTGCCTTCTCGAGAAGGCAGGCGTGAACGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-424s21c1
Sequence:GTACCGGGACCATCACCACCGCATACTACTCGAGTAGTATGCGGTGGTGATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002866.3-194s1c1
Sequence:CCGGCTACATGTTCAAGATTCTCATCTCGAGATGAGAATCTTGAACATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-447s1c1
Sequence:CCGGACCAACGAGGAATCCTTCAATCTCGAGATTGAAGGATTCCTCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002866.3-320s1c1
Sequence:CCGGGACCATCTATCGCAACGACAACTCGAGTTGTCGTTGCGATAGATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-686s1c1
Sequence:CCGGCGAGAAGATGTCCGAGTCGTTCTCGAGAACGACTCGGACATCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-513s21c1
Sequence:GTACCGGACTGGTCCACCCAGATCAAGACTCGAGTCTTGATCTGGGTGGACCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-202s21c1
Sequence:GTACCGGGAAGGAGTCCTCGGATCAGAACTCGAGTTCTGATCCGAGGACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-367s21c1
Sequence:GTACCGGCAACGACAAGAGGATCAAGCTCTCGAGAGCTTGATCCTCTTGTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-556s21c1
Sequence:GTACCGGGGTGCTGCTGGTAGGAAACAACTCGAGTTGTTTCCTACCAGCAGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-631s21c1
Sequence:GTACCGGTGACCACCTTGGGTTCGAGTTCTCGAGAACTCGAACCCAAGGTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002866
VALIDATED
RAB3A MISSION shRNA Lentiviral Transduction Particles
RAB3A, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-345s21c1
Sequence:GTACCGGTCAAGGTCAAGACCATCTATCCTCGAGGATAGATGGTCTTGACCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-722s21c1
Sequence:GTACCGGGAGAAGATGTCCGAGTCGTTGCTCGAGCAACGACTCGGACATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-266s1c1
Sequence:CCGGCGACTCGTTCACGCCTGCCTTCTCGAGAAGGCAGGCGTGAACGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-424s21c1
Sequence:GTACCGGGACCATCACCACCGCATACTACTCGAGTAGTATGCGGTGGTGATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002866.3-194s1c1
Sequence:CCGGCTACATGTTCAAGATTCTCATCTCGAGATGAGAATCTTGAACATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-447s1c1
Sequence:CCGGACCAACGAGGAATCCTTCAATCTCGAGATTGAAGGATTCCTCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002866.3-320s1c1
Sequence:CCGGGACCATCTATCGCAACGACAACTCGAGTTGTCGTTGCGATAGATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002866.3-686s1c1
Sequence:CCGGCGAGAAGATGTCCGAGTCGTTCTCGAGAACGACTCGGACATCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-513s21c1
Sequence:GTACCGGACTGGTCCACCCAGATCAAGACTCGAGTCTTGATCTGGGTGGACCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-202s21c1
Sequence:GTACCGGGAAGGAGTCCTCGGATCAGAACTCGAGTTCTGATCCGAGGACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-367s21c1
Sequence:GTACCGGCAACGACAAGAGGATCAAGCTCTCGAGAGCTTGATCCTCTTGTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-556s21c1
Sequence:GTACCGGGGTGCTGCTGGTAGGAAACAACTCGAGTTGTTTCCTACCAGCAGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002866.4-631s21c1
Sequence:GTACCGGTGACCACCTTGGGTTCGAGTTCTCGAGAACTCGAACCCAAGGTGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009001
VALIDATED
RAB3A MISSION shRNA Bacterial Glycerol Stock
RAB3A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-836s21c1
Sequence:CCGGCAGCGCCAAGGACAACATTAACTCGAGTTAATGTTGTCCTTGGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009001.2-1174s1c1
Sequence:CCGGGCCTTATACTTTGGGATAAATCTCGAGATTTATCCCAAAGTATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009001.2-204s1c1
Sequence:CCGGCGACTATATGTTCAAGATCCTCTCGAGAGGATCTTGAACATATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009001.2-460s1c1
Sequence:CCGGACCAATGAGGAGTCATTTAATCTCGAGATTAAATGACTCCTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009001.2-639s1c1
Sequence:CCGGCAGCGCCAAGGACAACATTAACTCGAGTTAATGTTGTCCTTGGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009001.2-458s1c1
Sequence:CCGGTCACCAATGAGGAGTCATTTACTCGAGTAAATGACTCCTCATTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-885s21c1
Sequence:CCGGGACGTGATCTGTGAGAAGATGCTCGAGCATCTTCTCACAGATCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009001.4-1167s21c1
Sequence:CCGGACTGCTGCTCCCTCTCCTTTACTCGAGTAAAGGAGAGGGAGCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-540s21c1
Sequence:CCGGCGCAACGACAAGAGGATCAAGCTCGAGCTTGATCCTCTTGTCGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-655s21c1
Sequence:CCGGTCACCAATGAGGAGTCATTTACTCGAGTAAATGACTCCTCATTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009001
VALIDATED
RAB3A MISSION shRNA shRNA Plasmid DNA
RAB3A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-836s21c1
Sequence:CCGGCAGCGCCAAGGACAACATTAACTCGAGTTAATGTTGTCCTTGGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009001.2-1174s1c1
Sequence:CCGGGCCTTATACTTTGGGATAAATCTCGAGATTTATCCCAAAGTATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009001.2-204s1c1
Sequence:CCGGCGACTATATGTTCAAGATCCTCTCGAGAGGATCTTGAACATATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009001.2-460s1c1
Sequence:CCGGACCAATGAGGAGTCATTTAATCTCGAGATTAAATGACTCCTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009001.2-639s1c1
Sequence:CCGGCAGCGCCAAGGACAACATTAACTCGAGTTAATGTTGTCCTTGGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009001.2-458s1c1
Sequence:CCGGTCACCAATGAGGAGTCATTTACTCGAGTAAATGACTCCTCATTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-885s21c1
Sequence:CCGGGACGTGATCTGTGAGAAGATGCTCGAGCATCTTCTCACAGATCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009001.4-1167s21c1
Sequence:CCGGACTGCTGCTCCCTCTCCTTTACTCGAGTAAAGGAGAGGGAGCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-540s21c1
Sequence:CCGGCGCAACGACAAGAGGATCAAGCTCGAGCTTGATCCTCTTGTCGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-655s21c1
Sequence:CCGGTCACCAATGAGGAGTCATTTACTCGAGTAAATGACTCCTCATTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009001
VALIDATED
RAB3A MISSION shRNA Lentiviral Transduction Particles
RAB3A, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-836s21c1
Sequence:CCGGCAGCGCCAAGGACAACATTAACTCGAGTTAATGTTGTCCTTGGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009001.2-1174s1c1
Sequence:CCGGGCCTTATACTTTGGGATAAATCTCGAGATTTATCCCAAAGTATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009001.2-204s1c1
Sequence:CCGGCGACTATATGTTCAAGATCCTCTCGAGAGGATCTTGAACATATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009001.2-460s1c1
Sequence:CCGGACCAATGAGGAGTCATTTAATCTCGAGATTAAATGACTCCTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009001.2-639s1c1
Sequence:CCGGCAGCGCCAAGGACAACATTAACTCGAGTTAATGTTGTCCTTGGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009001.2-458s1c1
Sequence:CCGGTCACCAATGAGGAGTCATTTACTCGAGTAAATGACTCCTCATTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-885s21c1
Sequence:CCGGGACGTGATCTGTGAGAAGATGCTCGAGCATCTTCTCACAGATCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009001.4-1167s21c1
Sequence:CCGGACTGCTGCTCCCTCTCCTTTACTCGAGTAAAGGAGAGGGAGCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-540s21c1
Sequence:CCGGCGCAACGACAAGAGGATCAAGCTCGAGCTTGATCCTCTTGTCGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009001.4-655s21c1
Sequence:CCGGTCACCAATGAGGAGTCATTTACTCGAGTAAATGACTCCTCATTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)