EMAIL THIS PAGE TO A FRIEND

RAB3C

RAB3C, member RAS oncogene family

52 Gene Product Result for
UniProtKB ID: Q96E17
Gene ID:
Human(115827) Summary: RAB proteins, such as RAB3C, are small GTPases implicated in the regulation of vesicular trafficking between membrane compartments (Cheng et al., 2002 [PubMed 12296628]
Mouse(67295) RAB3C, member RAS oncogene family
Rat(171058) RAB3C, member RAS oncogene family
cow(338100) RAB3C, member RAS oncogene family
sheep(101110089) RAB3C, member RAS oncogene family
cow(617600) RAB3C, member RAS oncogene family
naked mole-rat(101716491) RAB3C, member RAS oncogene family
domestic guinea pig(100717651) RAB3C, member RAS oncogene family
Zebrafish(436803) RAB3C, member RAS oncogene family
domestic cat(101092583) RAB3C, member RAS oncogene family
dog(608817) RAB3C, member RAS oncogene family
chicken(770370) RAB3C, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138453 Rosetta Predictions human pricing
NM_133536 Rosetta Predictions rat pricing
NM_023852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214108 predicted 635
2 SASI_Hs01_00214109 predicted 238
3 SASI_Hs01_00214110 predicted 481
4 SASI_Hs01_00214111 predicted 274
5 SASI_Hs01_00214112 predicted 326
6 SASI_Hs01_00214113 predicted 575
7 SASI_Hs01_00214114 predicted 414
8 SASI_Hs01_00214115 predicted 649
9 SASI_Hs01_00214116 predicted 675
10 SASI_Hs01_00214117 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267722 predicted 479
2 SASI_Rn01_00075390 predicted 491
3 SASI_Rn01_00075392 predicted 628
4 SASI_Rn01_00075393 predicted 315
5 SASI_Rn01_00075394 predicted 680
6 SASI_Rn01_00075395 predicted 528
7 SASI_Rn01_00075396 predicted 754
8 SASI_Rn01_00075397 predicted 495
9 SASI_Rn01_00075398 predicted 438
10 SASI_Rn01_00075399 predicted 707
11 SASI_Rn01_00075391 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149921 predicted 870
2 SASI_Mm01_00149922 predicted 875
3 SASI_Mm01_00149923 predicted 882
4 SASI_Mm02_00327404 predicted 566
5 SASI_Mm01_00149924 predicted 525
6 SASI_Mm01_00149925 predicted 260
7 SASI_Mm01_00149926 predicted 889
8 SASI_Mm01_00149927 predicted 985
9 SASI_Mm01_00149928 predicted 865
10 SASI_Mm01_00149930 predicted 613
11 SASI_Mm01_00149929 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138453
RAB3C MISSION shRNA Bacterial Glycerol Stock
RAB3C, member RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-566s1c1
Sequence:CCGGCGAGGTCAACATTTAGGAGAACTCGAGTTCTCCTAAATGTTGACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-558s21c1
Sequence:GTACCGGCAACTGAGCGAGGTCAACATTCTCGAGAATGTTGACCTCGCTCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-646s21c1
Sequence:GTACCGGATTTGAGCGCCTTGTGGATATCTCGAGATATCCACAAGGCGCTCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-193s21c1
Sequence:GTACCGGATTACTCATCATCGGCAATAGCTCGAGCTATTGCCGATGATGAGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138453.2-858s21c1
Sequence:GTACCGGCATTTATACTGCCTAACAATTCTCGAGAATTGTTAGGCAGTATAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-242s1c1
Sequence:CCGGCGTTATGCAGATGACTCCTTTCTCGAGAAAGGAGTCATCTGCATAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-683s1c1
Sequence:CCGGTCAGAGAGTTTGGAGACTGATCTCGAGATCAGTCTCCAAACTCTCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-447s1c1
Sequence:CCGGCCTTCAATGCAGTACAAGATTCTCGAGAATCTTGTACTGCATTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-361s1c1
Sequence:CCGGCCAGGAAAGATACAGGACTATCTCGAGATAGTCCTGTATCTTTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-327s21c1
Sequence:GTACCGGAGAGAATCAAGCTTCAGATTTCTCGAGAAATCTGAAGCTTGATTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-159s21c1
Sequence:GTACCGGACTCCTCTGATCAGAACTTTGCTCGAGCAAAGTTCTGATCAGAGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138453
RAB3C MISSION shRNA shRNA Plasmid DNA
RAB3C, member RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-566s1c1
Sequence:CCGGCGAGGTCAACATTTAGGAGAACTCGAGTTCTCCTAAATGTTGACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-558s21c1
Sequence:GTACCGGCAACTGAGCGAGGTCAACATTCTCGAGAATGTTGACCTCGCTCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-646s21c1
Sequence:GTACCGGATTTGAGCGCCTTGTGGATATCTCGAGATATCCACAAGGCGCTCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-193s21c1
Sequence:GTACCGGATTACTCATCATCGGCAATAGCTCGAGCTATTGCCGATGATGAGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138453.2-858s21c1
Sequence:GTACCGGCATTTATACTGCCTAACAATTCTCGAGAATTGTTAGGCAGTATAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-242s1c1
Sequence:CCGGCGTTATGCAGATGACTCCTTTCTCGAGAAAGGAGTCATCTGCATAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-683s1c1
Sequence:CCGGTCAGAGAGTTTGGAGACTGATCTCGAGATCAGTCTCCAAACTCTCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-447s1c1
Sequence:CCGGCCTTCAATGCAGTACAAGATTCTCGAGAATCTTGTACTGCATTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-361s1c1
Sequence:CCGGCCAGGAAAGATACAGGACTATCTCGAGATAGTCCTGTATCTTTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-327s21c1
Sequence:GTACCGGAGAGAATCAAGCTTCAGATTTCTCGAGAAATCTGAAGCTTGATTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-159s21c1
Sequence:GTACCGGACTCCTCTGATCAGAACTTTGCTCGAGCAAAGTTCTGATCAGAGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138453
RAB3C MISSION shRNA Lentiviral Transduction Particles
RAB3C, member RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-566s1c1
Sequence:CCGGCGAGGTCAACATTTAGGAGAACTCGAGTTCTCCTAAATGTTGACCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-558s21c1
Sequence:GTACCGGCAACTGAGCGAGGTCAACATTCTCGAGAATGTTGACCTCGCTCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-646s21c1
Sequence:GTACCGGATTTGAGCGCCTTGTGGATATCTCGAGATATCCACAAGGCGCTCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-193s21c1
Sequence:GTACCGGATTACTCATCATCGGCAATAGCTCGAGCTATTGCCGATGATGAGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138453.2-858s21c1
Sequence:GTACCGGCATTTATACTGCCTAACAATTCTCGAGAATTGTTAGGCAGTATAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-242s1c1
Sequence:CCGGCGTTATGCAGATGACTCCTTTCTCGAGAAAGGAGTCATCTGCATAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-683s1c1
Sequence:CCGGTCAGAGAGTTTGGAGACTGATCTCGAGATCAGTCTCCAAACTCTCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-447s1c1
Sequence:CCGGCCTTCAATGCAGTACAAGATTCTCGAGAATCTTGTACTGCATTGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138453.2-361s1c1
Sequence:CCGGCCAGGAAAGATACAGGACTATCTCGAGATAGTCCTGTATCTTTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-327s21c1
Sequence:GTACCGGAGAGAATCAAGCTTCAGATTTCTCGAGAAATCTGAAGCTTGATTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138453.2-159s21c1
Sequence:GTACCGGACTCCTCTGATCAGAACTTTGCTCGAGCAAAGTTCTGATCAGAGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023852
RAB3C MISSION shRNA Bacterial Glycerol Stock
RAB3C, member RAS oncogene family
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023852.2-924s1c1
Sequence:CCGGCCTGTGTTAATATGTGGCAAACTCGAGTTTGCCACATATTAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-225s1c1
Sequence:CCGGTGTTCCGTTATGCCGACGATTCTCGAGAATCGTCGGCATAACGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-492s1c1
Sequence:CCGGCCCAGGTTATCCTGGCTGGAACTCGAGTTCCAGCCAGGATAACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-611s1c1
Sequence:CCGGGATAACATCAACGTGAAGCAACTCGAGTTGCTTCACGTTGATGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-241s1c1
Sequence:CCGGCGATTCCTTTACATCTGCATTCTCGAGAATGCAGATGTAAAGGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-334s21c1
Sequence:GTACCGGGTTATGCCGACGATTCCTTTACTCGAGTAAAGGAATCGTCGGCATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-369s21c1
Sequence:GTACCGGAGCACGGTTGGCATCGATTTCCTCGAGGAAATCGATGCCAACCGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-283s21c1
Sequence:GTACCGGAGTTGCTGATCATTGGCAATACTCGAGTATTGCCAATGATCAGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023852
RAB3C MISSION shRNA shRNA Plasmid DNA
RAB3C, member RAS oncogene family
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023852.2-924s1c1
Sequence:CCGGCCTGTGTTAATATGTGGCAAACTCGAGTTTGCCACATATTAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-225s1c1
Sequence:CCGGTGTTCCGTTATGCCGACGATTCTCGAGAATCGTCGGCATAACGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-492s1c1
Sequence:CCGGCCCAGGTTATCCTGGCTGGAACTCGAGTTCCAGCCAGGATAACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-611s1c1
Sequence:CCGGGATAACATCAACGTGAAGCAACTCGAGTTGCTTCACGTTGATGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-241s1c1
Sequence:CCGGCGATTCCTTTACATCTGCATTCTCGAGAATGCAGATGTAAAGGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-334s21c1
Sequence:GTACCGGGTTATGCCGACGATTCCTTTACTCGAGTAAAGGAATCGTCGGCATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-369s21c1
Sequence:GTACCGGAGCACGGTTGGCATCGATTTCCTCGAGGAAATCGATGCCAACCGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-283s21c1
Sequence:GTACCGGAGTTGCTGATCATTGGCAATACTCGAGTATTGCCAATGATCAGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023852
RAB3C MISSION shRNA Lentiviral Transduction Particles
RAB3C, member RAS oncogene family
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023852.2-924s1c1
Sequence:CCGGCCTGTGTTAATATGTGGCAAACTCGAGTTTGCCACATATTAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-225s1c1
Sequence:CCGGTGTTCCGTTATGCCGACGATTCTCGAGAATCGTCGGCATAACGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-492s1c1
Sequence:CCGGCCCAGGTTATCCTGGCTGGAACTCGAGTTCCAGCCAGGATAACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-611s1c1
Sequence:CCGGGATAACATCAACGTGAAGCAACTCGAGTTGCTTCACGTTGATGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023852.2-241s1c1
Sequence:CCGGCGATTCCTTTACATCTGCATTCTCGAGAATGCAGATGTAAAGGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-334s21c1
Sequence:GTACCGGGTTATGCCGACGATTCCTTTACTCGAGTAAAGGAATCGTCGGCATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-369s21c1
Sequence:GTACCGGAGCACGGTTGGCATCGATTTCCTCGAGGAAATCGATGCCAACCGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023852.5-283s21c1
Sequence:GTACCGGAGTTGCTGATCATTGGCAATACTCGAGTATTGCCAATGATCAGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)