EMAIL THIS PAGE TO A FRIEND

RAB3D

RAB3D, member RAS oncogene family

62 Gene Product Result for
Synonyms: D2-2 GOV RAB16 RAD3D
UniProtKB ID: O95716
Gene ID:
Mouse(19340) RAB3D, member RAS oncogene family
Rat(140665) RAB3D, member RAS oncogene family
domestic cat(101097793) RAB3D, member RAS oncogene family
dog(476708) RAB3D, member RAS oncogene family
domestic guinea pig(100725066) RAB3D, member RAS oncogene family
naked mole-rat(101707690) RAB3D, member RAS oncogene family
cow(100139105) RAB3D, member RAS oncogene family
sheep(101117755) RAB3D, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0240 AQUA Peptide LLLIGNSSVG[K] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004283 Rosetta Predictions human pricing
NM_080580 Rosetta Predictions rat pricing
NM_031874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092527 predicted 1326
2 SASI_Hs01_00092528 predicted 1231
3 SASI_Hs01_00092530 predicted 1185
4 SASI_Hs01_00092532 predicted 341
5 SASI_Hs01_00092533 predicted 1322
6 SASI_Hs01_00092534 predicted 1133
7 SASI_Hs01_00092535 predicted 394
8 SASI_Hs01_00092536 predicted 434
9 SASI_Hs02_00337271 predicted 333
10 SASI_Hs02_00337272 predicted 602
11 SASI_Hs01_00092529 predicted 1331
12 SASI_Hs01_00092531 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082444 predicted 1004
2 SASI_Rn01_00082445 predicted 1239
3 SASI_Rn01_00082446 predicted 1163
4 SASI_Rn01_00082447 predicted 904
5 SASI_Rn01_00082448 predicted 361
6 SASI_Rn01_00082450 predicted 755
7 SASI_Rn01_00082451 predicted 1261
8 SASI_Rn01_00082452 predicted 1083
9 SASI_Rn01_00082453 predicted 1199
10 SASI_Rn02_00267243 predicted 1109
11 SASI_Rn01_00082449 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170153 predicted 658
2 SASI_Mm01_00170154 predicted 1008
3 SASI_Mm02_00337187 predicted 1037
4 SASI_Mm01_00170156 predicted 485
5 SASI_Mm02_00337188 predicted 1156
6 SASI_Mm01_00170157 predicted 1280
7 SASI_Mm02_00337189 predicted 1217
8 SASI_Mm01_00170159 predicted 332
9 SASI_Mm02_00337190 predicted 917
10 SASI_Mm01_00170162 predicted 416
11 SASI_Mm01_00170155 predicted 1161
12 SASI_Mm01_00170158 predicted 1203
13 SASI_Mm01_00170160 predicted 1338
14 SASI_Mm01_00170161 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004283
VALIDATED
RAB3D MISSION shRNA Bacterial Glycerol Stock
RAB3D, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1030s21c1
Sequence:CCGGATGGCTCATTCCTTCACAATGCTCGAGCATTGTGAAGGAATGAGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1273s21c1
Sequence:CCGGGGTTGGGCAGGACTGATATTCCTCGAGGAATATCAGTCCTGCCCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-587s21c1
Sequence:CCGGGCCACGCAAATCAAGACCTACCTCGAGGTAGGTCTTGATTTGCGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1237s21c1
Sequence:CCGGCCTTCTAGCTTAGAACCATTTCTCGAGAAATGGTTCTAAGCTAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-344s21c1
Sequence:CCGGACTTCCTTCCTGTTCCGATACCTCGAGGTATCGGAACAGGAAGGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-395s21c1
Sequence:CCGGAGTACTGTGGGCATCGATTTCCTCGAGGAAATCGATGCCCACAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1297s21c1
Sequence:CCGGAGCTGGTGGAAGATGGTTCATCTCGAGATGAACCATCTTCCACCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-747s21c1
Sequence:CCGGTCAATGTGAAGCAGGTCTTCGCTCGAGCGAAGACCTGCTTCACATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-1236s1c1
Sequence:CCGGGCCTTCTAGCTTAGAACCATTCTCGAGAATGGTTCTAAGCTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004283.2-296s1c1
Sequence:CCGGGACTATATGTTCAAACTGCTACTCGAGTAGCAGTTTGAACATATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004283.2-745s1c1
Sequence:CCGGCATCAATGTGAAGCAGGTCTTCTCGAGAAGACCTGCTTCACATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-547s1c1
Sequence:CCGGCATCGCCAATCAGGAATCCTTCTCGAGAAGGATTCCTGATTGGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-343s1c1
Sequence:CCGGGACTTCCTTCCTGTTCCGATACTCGAGTATCGGAACAGGAAGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004283
VALIDATED
RAB3D MISSION shRNA shRNA Plasmid DNA
RAB3D, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1030s21c1
Sequence:CCGGATGGCTCATTCCTTCACAATGCTCGAGCATTGTGAAGGAATGAGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1273s21c1
Sequence:CCGGGGTTGGGCAGGACTGATATTCCTCGAGGAATATCAGTCCTGCCCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-587s21c1
Sequence:CCGGGCCACGCAAATCAAGACCTACCTCGAGGTAGGTCTTGATTTGCGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1237s21c1
Sequence:CCGGCCTTCTAGCTTAGAACCATTTCTCGAGAAATGGTTCTAAGCTAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-344s21c1
Sequence:CCGGACTTCCTTCCTGTTCCGATACCTCGAGGTATCGGAACAGGAAGGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-395s21c1
Sequence:CCGGAGTACTGTGGGCATCGATTTCCTCGAGGAAATCGATGCCCACAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1297s21c1
Sequence:CCGGAGCTGGTGGAAGATGGTTCATCTCGAGATGAACCATCTTCCACCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-747s21c1
Sequence:CCGGTCAATGTGAAGCAGGTCTTCGCTCGAGCGAAGACCTGCTTCACATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-1236s1c1
Sequence:CCGGGCCTTCTAGCTTAGAACCATTCTCGAGAATGGTTCTAAGCTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004283.2-296s1c1
Sequence:CCGGGACTATATGTTCAAACTGCTACTCGAGTAGCAGTTTGAACATATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004283.2-745s1c1
Sequence:CCGGCATCAATGTGAAGCAGGTCTTCTCGAGAAGACCTGCTTCACATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-547s1c1
Sequence:CCGGCATCGCCAATCAGGAATCCTTCTCGAGAAGGATTCCTGATTGGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-343s1c1
Sequence:CCGGGACTTCCTTCCTGTTCCGATACTCGAGTATCGGAACAGGAAGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004283
VALIDATED
RAB3D MISSION shRNA Lentiviral Transduction Particles
RAB3D, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1030s21c1
Sequence:CCGGATGGCTCATTCCTTCACAATGCTCGAGCATTGTGAAGGAATGAGCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1273s21c1
Sequence:CCGGGGTTGGGCAGGACTGATATTCCTCGAGGAATATCAGTCCTGCCCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-587s21c1
Sequence:CCGGGCCACGCAAATCAAGACCTACCTCGAGGTAGGTCTTGATTTGCGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1237s21c1
Sequence:CCGGCCTTCTAGCTTAGAACCATTTCTCGAGAAATGGTTCTAAGCTAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-344s21c1
Sequence:CCGGACTTCCTTCCTGTTCCGATACCTCGAGGTATCGGAACAGGAAGGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-395s21c1
Sequence:CCGGAGTACTGTGGGCATCGATTTCCTCGAGGAAATCGATGCCCACAGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004283.2-1297s21c1
Sequence:CCGGAGCTGGTGGAAGATGGTTCATCTCGAGATGAACCATCTTCCACCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004283.2-747s21c1
Sequence:CCGGTCAATGTGAAGCAGGTCTTCGCTCGAGCGAAGACCTGCTTCACATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-1236s1c1
Sequence:CCGGGCCTTCTAGCTTAGAACCATTCTCGAGAATGGTTCTAAGCTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004283.2-296s1c1
Sequence:CCGGGACTATATGTTCAAACTGCTACTCGAGTAGCAGTTTGAACATATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004283.2-745s1c1
Sequence:CCGGCATCAATGTGAAGCAGGTCTTCTCGAGAAGACCTGCTTCACATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-547s1c1
Sequence:CCGGCATCGCCAATCAGGAATCCTTCTCGAGAAGGATTCCTGATTGGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004283.2-343s1c1
Sequence:CCGGGACTTCCTTCCTGTTCCGATACTCGAGTATCGGAACAGGAAGGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031874
VALIDATED
RAB3D MISSION shRNA Bacterial Glycerol Stock
RAB3D, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-429s21c1
Sequence:CCGGCCGACATGACAAGAGGATCAACTCGAGTTGATCCTCTTGTCATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-777s21c1
Sequence:CCGGCATCATCTGTGACAAGATGAACTCGAGTTCATCTTGTCACAGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-577s21c1
Sequence:GTACCGGGACTGGGCTACGCAGATCAAACTCGAGTTTGATCTGCGTAGCCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031874.3-303s1c1
Sequence:CCGGCAAACTGCTCTTGATCGGGAACTCGAGTTCCCGATCAAGAGCAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031874.3-2349s1c1
Sequence:CCGGCGGTGCAAATTATGTTCTTAACTCGAGTTAAGAACATAATTTGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031874.3-777s1c1
Sequence:CCGGCATCATCTGTGACAAGATGAACTCGAGTTCATCTTGTCACAGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031874.3-426s1c1
Sequence:CCGGCTACCGACATGACAAGAGGATCTCGAGATCCTCTTGTCATGTCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031874.3-429s1c1
Sequence:CCGGCCGACATGACAAGAGGATCAACTCGAGTTGATCCTCTTGTCATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-690s21c1
Sequence:GTACCGGGCTCGCCGATGATCTTGGTTTCTCGAGAAACCAAGATCATCGGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-401s21c1
Sequence:CCGGGCATCGACTTCAAGGTCAAGACTCGAGTCTTGACCTTGAAGTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031874
VALIDATED
RAB3D MISSION shRNA shRNA Plasmid DNA
RAB3D, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-429s21c1
Sequence:CCGGCCGACATGACAAGAGGATCAACTCGAGTTGATCCTCTTGTCATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-777s21c1
Sequence:CCGGCATCATCTGTGACAAGATGAACTCGAGTTCATCTTGTCACAGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-577s21c1
Sequence:GTACCGGGACTGGGCTACGCAGATCAAACTCGAGTTTGATCTGCGTAGCCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031874.3-303s1c1
Sequence:CCGGCAAACTGCTCTTGATCGGGAACTCGAGTTCCCGATCAAGAGCAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031874.3-2349s1c1
Sequence:CCGGCGGTGCAAATTATGTTCTTAACTCGAGTTAAGAACATAATTTGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031874.3-777s1c1
Sequence:CCGGCATCATCTGTGACAAGATGAACTCGAGTTCATCTTGTCACAGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031874.3-426s1c1
Sequence:CCGGCTACCGACATGACAAGAGGATCTCGAGATCCTCTTGTCATGTCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031874.3-429s1c1
Sequence:CCGGCCGACATGACAAGAGGATCAACTCGAGTTGATCCTCTTGTCATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-690s21c1
Sequence:GTACCGGGCTCGCCGATGATCTTGGTTTCTCGAGAAACCAAGATCATCGGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-401s21c1
Sequence:CCGGGCATCGACTTCAAGGTCAAGACTCGAGTCTTGACCTTGAAGTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031874
VALIDATED
RAB3D MISSION shRNA Lentiviral Transduction Particles
RAB3D, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-429s21c1
Sequence:CCGGCCGACATGACAAGAGGATCAACTCGAGTTGATCCTCTTGTCATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-777s21c1
Sequence:CCGGCATCATCTGTGACAAGATGAACTCGAGTTCATCTTGTCACAGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-577s21c1
Sequence:GTACCGGGACTGGGCTACGCAGATCAAACTCGAGTTTGATCTGCGTAGCCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031874.3-303s1c1
Sequence:CCGGCAAACTGCTCTTGATCGGGAACTCGAGTTCCCGATCAAGAGCAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031874.3-2349s1c1
Sequence:CCGGCGGTGCAAATTATGTTCTTAACTCGAGTTAAGAACATAATTTGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031874.3-777s1c1
Sequence:CCGGCATCATCTGTGACAAGATGAACTCGAGTTCATCTTGTCACAGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031874.3-426s1c1
Sequence:CCGGCTACCGACATGACAAGAGGATCTCGAGATCCTCTTGTCATGTCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031874.3-429s1c1
Sequence:CCGGCCGACATGACAAGAGGATCAACTCGAGTTGATCCTCTTGTCATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-690s21c1
Sequence:GTACCGGGCTCGCCGATGATCTTGGTTTCTCGAGAAACCAAGATCATCGGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031874.4-401s21c1
Sequence:CCGGGCATCGACTTCAAGGTCAAGACTCGAGTCTTGACCTTGAAGTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)