EMAIL THIS PAGE TO A FRIEND

RAB3GAP1

RAB3 GTPase activating protein subunit 1 (catalytic)

92 Gene Product Result for
Synonyms: P130 RAB3GAP RAB3GAP130 WARBM1
UniProtKB ID: Q15042, Q659F5, Q8TBB4
Gene ID:
Human(22930) Summary: This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Mouse(226407) RAB3 GTPase activating protein subunit 1
Zebrafish(777744) RAB3 GTPase activating protein subunit 1
chicken(424290) RAB3 GTPase activating protein subunit 1 (catalytic)
dog(476127) RAB3 GTPase activating protein subunit 1 (catalytic)
Horse(100050665) RAB3 GTPase activating protein subunit 1 (catalytic)
domestic cat(101090959) RAB3 GTPase activating protein subunit 1 (catalytic)
cow(535393) RAB3 GTPase activating protein subunit 1 (catalytic)
sheep(101105474) RAB3 GTPase activating protein subunit 1 (catalytic)
naked mole-rat(101726563) RAB3 GTPase activating protein subunit 1 (catalytic)
domestic guinea pig(100732896) RAB3 GTPase activating protein subunit 1 (catalytic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012233 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012233 Rosetta Predictions human pricing
NM_178690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343917 predicted 374
2 SASI_Hs01_00036126 predicted 1219
3 SASI_Hs01_00036128 predicted 541
4 SASI_Hs01_00036129 predicted 838
5 SASI_Hs01_00036130 predicted 594
6 SASI_Hs01_00036131 predicted 320
7 SASI_Hs01_00036132 predicted 1026
8 SASI_Hs01_00036133 predicted 260
9 SASI_Hs01_00036134 predicted 1285
10 SASI_Hs02_00343918 predicted 443
11 SASI_Hs01_00036127 predicted 292
12 SASI_Hs01_00036135 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183650 predicted 334
2 SASI_Mm01_00183651 predicted 1108
3 SASI_Mm01_00183652 predicted 2583
4 SASI_Mm01_00183653 predicted 260
5 SASI_Mm01_00183654 predicted 390
6 SASI_Mm02_00349180 predicted 1590
7 SASI_Mm02_00349181 predicted 861
8 SASI_Mm01_00183657 predicted 1238
9 SASI_Mm01_00183658 predicted 330
10 SASI_Mm02_00349182 predicted 627
11 SASI_Mm01_00183655 predicted 897
12 SASI_Mm01_00183656 predicted 1564
13 SASI_Mm01_00183659 predicted 1283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012233
VALIDATED
RAB3GAP1 MISSION shRNA Bacterial Glycerol Stock
RAB3 GTPase activating protein subunit 1 (catalytic)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-983s21c1
Sequence:CCGGCCTCAGTGTTTGCTAGGTGATCTCGAGATCACCTAGCAAACACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-581s21c1
Sequence:CCGGGTACGAACTGATTTCGAAATGCTCGAGCATTTCGAAATCAGTTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-1216s21c1
Sequence:CCGGAGAGGAGTCACCGCTAAATAACTCGAGTTATTTAGCGGTGACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-3340s21c1
Sequence:CCGGACACTTCGTGGTTCTATATATCTCGAGATATATAGAACCACGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-2207s21c1
Sequence:CCGGCGGATGAAGATTCCAAGCAATCTCGAGATTGCTTGGAATCTTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-983s1c1
Sequence:CCGGCCTCAGTGTTTGCTAGGTGATCTCGAGATCACCTAGCAAACACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012233.1-3193s1c1
Sequence:CCGGCCCTAGAGATGGCCTTTGTATCTCGAGATACAAAGGCCATCTCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-2207s1c1
Sequence:CCGGCGGATGAAGATTCCAAGCAATCTCGAGATTGCTTGGAATCTTCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-1070s1c1
Sequence:CCGGGCATTTGAGGAAGAAGGCAAACTCGAGTTTGCCTTCTTCCTCAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-545s1c1
Sequence:CCGGCGAAGAATGTATGTAGGAGAACTCGAGTTCTCCTACATACATTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-893s1c1
Sequence:CCGGGAAGGGATCATTGTGGATAATCTCGAGATTATCCACAATGATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-119s1c1
Sequence:CCGGGAAGTCTTGAATGACTGGAAACTCGAGTTTCCAGTCATTCAAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-694s1c1
Sequence:CCGGGCCTCCAGTTAGTATTGCTATCTCGAGATAGCAATACTAACTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012233
VALIDATED
RAB3GAP1 MISSION shRNA shRNA Plasmid DNA
RAB3 GTPase activating protein subunit 1 (catalytic)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-983s21c1
Sequence:CCGGCCTCAGTGTTTGCTAGGTGATCTCGAGATCACCTAGCAAACACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-581s21c1
Sequence:CCGGGTACGAACTGATTTCGAAATGCTCGAGCATTTCGAAATCAGTTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-1216s21c1
Sequence:CCGGAGAGGAGTCACCGCTAAATAACTCGAGTTATTTAGCGGTGACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-3340s21c1
Sequence:CCGGACACTTCGTGGTTCTATATATCTCGAGATATATAGAACCACGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-2207s21c1
Sequence:CCGGCGGATGAAGATTCCAAGCAATCTCGAGATTGCTTGGAATCTTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-983s1c1
Sequence:CCGGCCTCAGTGTTTGCTAGGTGATCTCGAGATCACCTAGCAAACACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012233.1-3193s1c1
Sequence:CCGGCCCTAGAGATGGCCTTTGTATCTCGAGATACAAAGGCCATCTCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-2207s1c1
Sequence:CCGGCGGATGAAGATTCCAAGCAATCTCGAGATTGCTTGGAATCTTCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-1070s1c1
Sequence:CCGGGCATTTGAGGAAGAAGGCAAACTCGAGTTTGCCTTCTTCCTCAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-545s1c1
Sequence:CCGGCGAAGAATGTATGTAGGAGAACTCGAGTTCTCCTACATACATTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-893s1c1
Sequence:CCGGGAAGGGATCATTGTGGATAATCTCGAGATTATCCACAATGATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-119s1c1
Sequence:CCGGGAAGTCTTGAATGACTGGAAACTCGAGTTTCCAGTCATTCAAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-694s1c1
Sequence:CCGGGCCTCCAGTTAGTATTGCTATCTCGAGATAGCAATACTAACTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012233
VALIDATED
RAB3GAP1 MISSION shRNA Lentiviral Transduction Particles
RAB3 GTPase activating protein subunit 1 (catalytic)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-983s21c1
Sequence:CCGGCCTCAGTGTTTGCTAGGTGATCTCGAGATCACCTAGCAAACACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-581s21c1
Sequence:CCGGGTACGAACTGATTTCGAAATGCTCGAGCATTTCGAAATCAGTTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-1216s21c1
Sequence:CCGGAGAGGAGTCACCGCTAAATAACTCGAGTTATTTAGCGGTGACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-3340s21c1
Sequence:CCGGACACTTCGTGGTTCTATATATCTCGAGATATATAGAACCACGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012233.1-2207s21c1
Sequence:CCGGCGGATGAAGATTCCAAGCAATCTCGAGATTGCTTGGAATCTTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-983s1c1
Sequence:CCGGCCTCAGTGTTTGCTAGGTGATCTCGAGATCACCTAGCAAACACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012233.1-3193s1c1
Sequence:CCGGCCCTAGAGATGGCCTTTGTATCTCGAGATACAAAGGCCATCTCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-2207s1c1
Sequence:CCGGCGGATGAAGATTCCAAGCAATCTCGAGATTGCTTGGAATCTTCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-1070s1c1
Sequence:CCGGGCATTTGAGGAAGAAGGCAAACTCGAGTTTGCCTTCTTCCTCAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-545s1c1
Sequence:CCGGCGAAGAATGTATGTAGGAGAACTCGAGTTCTCCTACATACATTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012233.1-893s1c1
Sequence:CCGGGAAGGGATCATTGTGGATAATCTCGAGATTATCCACAATGATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-119s1c1
Sequence:CCGGGAAGTCTTGAATGACTGGAAACTCGAGTTTCCAGTCATTCAAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_012233.1-694s1c1
Sequence:CCGGGCCTCCAGTTAGTATTGCTATCTCGAGATAGCAATACTAACTGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178690
VALIDATED
RAB3GAP1 MISSION shRNA Bacterial Glycerol Stock
RAB3 GTPase activating protein subunit 1 (catalytic)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178690.2-2124s1c1
Sequence:CCGGGTACTCACCAAGGGACTACATCTCGAGATGTAGTCCCTTGGTGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-980s1c1
Sequence:CCGGCCCAGTGCTTACTAGGTGATTCTCGAGAATCACCTAGTAAGCACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-541s1c1
Sequence:CCGGCGACGAATGTACATGGGAGAACTCGAGTTCTCCCATGTACATTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-981s1c1
Sequence:CCGGCCAGTGCTTACTAGGTGATTTCTCGAGAAATCACCTAGTAAGCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-333s1c1
Sequence:CCGGGCTATGTATGAATAACGACTTCTCGAGAAGTCGTTATTCATACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178690.2-876s1c1
Sequence:CCGGGCCTCATTTGACAGAAGGGATCTCGAGATCCCTTCTGTCAAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-1043s1c1
Sequence:CCGGCGGATGAAATTCTTGGACGATCTCGAGATCGTCCAAGAATTTCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178690
VALIDATED
RAB3GAP1 MISSION shRNA shRNA Plasmid DNA
RAB3 GTPase activating protein subunit 1 (catalytic)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178690.2-2124s1c1
Sequence:CCGGGTACTCACCAAGGGACTACATCTCGAGATGTAGTCCCTTGGTGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-980s1c1
Sequence:CCGGCCCAGTGCTTACTAGGTGATTCTCGAGAATCACCTAGTAAGCACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-541s1c1
Sequence:CCGGCGACGAATGTACATGGGAGAACTCGAGTTCTCCCATGTACATTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-981s1c1
Sequence:CCGGCCAGTGCTTACTAGGTGATTTCTCGAGAAATCACCTAGTAAGCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-333s1c1
Sequence:CCGGGCTATGTATGAATAACGACTTCTCGAGAAGTCGTTATTCATACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178690.2-876s1c1
Sequence:CCGGGCCTCATTTGACAGAAGGGATCTCGAGATCCCTTCTGTCAAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-1043s1c1
Sequence:CCGGCGGATGAAATTCTTGGACGATCTCGAGATCGTCCAAGAATTTCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178690
VALIDATED
RAB3GAP1 MISSION shRNA Lentiviral Transduction Particles
RAB3 GTPase activating protein subunit 1 (catalytic)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178690.2-2124s1c1
Sequence:CCGGGTACTCACCAAGGGACTACATCTCGAGATGTAGTCCCTTGGTGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-980s1c1
Sequence:CCGGCCCAGTGCTTACTAGGTGATTCTCGAGAATCACCTAGTAAGCACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-541s1c1
Sequence:CCGGCGACGAATGTACATGGGAGAACTCGAGTTCTCCCATGTACATTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-981s1c1
Sequence:CCGGCCAGTGCTTACTAGGTGATTTCTCGAGAAATCACCTAGTAAGCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-333s1c1
Sequence:CCGGGCTATGTATGAATAACGACTTCTCGAGAAGTCGTTATTCATACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178690.2-876s1c1
Sequence:CCGGGCCTCATTTGACAGAAGGGATCTCGAGATCCCTTCTGTCAAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178690.2-1043s1c1
Sequence:CCGGCGGATGAAATTCTTGGACGATCTCGAGATCGTCCAAGAATTTCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)