EMAIL THIS PAGE TO A FRIEND

RAB3GAP2

RAB3 GTPase activating protein subunit 2 (non-catalytic)

200 Gene Product Result for
Synonyms: RAB3-GAP150 RAB3GAP150 WARBM2 p150
UniProtKB ID: Q9H2M9, A6H8V0, O75872, Q9HAB0, Q9UFJ7, Q9UQ15
Gene ID:
Human(25782) Summary: The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]
Mouse(98732) RAB3 GTPase activating protein subunit 2
Rat(289350) RAB3 GTPase activating protein subunit 2
domestic guinea pig(100716282) RAB3 GTPase activating protein subunit 2 (non-catalytic)
naked mole-rat(101710554) RAB3 GTPase activating protein subunit 2 (non-catalytic)
Domestic Rabbit(100339922) RAB3 GTPase activating protein subunit 2 (non-catalytic)
cow(539227) RAB3 GTPase activating protein subunit 2 (non-catalytic)
sheep(101105266) RAB3 GTPase activating protein subunit 2 (non-catalytic)
Zebrafish(368905) RAB3 GTPase activating protein subunit 2 (non-catalytic)
chicken(421343) RAB3 GTPase activating protein subunit 2 (non-catalytic)
Horse(100049979) RAB3 GTPase activating protein subunit 2 (non-catalytic)
dog(478964) RAB3 GTPase activating protein subunit 2 (non-catalytic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012414 Rosetta Predictions human pricing
NM_001040154 Rosetta Predictions rat pricing
XM_001064454 Rosetta Predictions rat pricing
XM_001081955 Rosetta Predictions rat pricing
XM_980542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344266 predicted 3750
2 SASI_Hs01_00022372 predicted 3812
3 SASI_Hs01_00022373 predicted 3642
4 SASI_Hs01_00022374 predicted 3048
5 SASI_Hs01_00022376 predicted 3903
6 SASI_Hs02_00344267 predicted 981
7 SASI_Hs02_00344268 predicted 619
8 SASI_Hs01_00022377 predicted 1669
9 SASI_Hs01_00022378 predicted 720
10 SASI_Hs02_00344269 predicted 2266
11 SASI_Hs01_00022375 predicted 805
12 SASI_Hs01_00022379 predicted 3244
13 SASI_Hs01_00022380 predicted 483
14 SASI_Hs01_00022381 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052691 predicted 870
2 SASI_Rn01_00052692 predicted 723
3 SASI_Rn02_00204892 predicted 453
4 SASI_Rn01_00052693 predicted 671
5 SASI_Rn01_00052694 predicted 624
6 SASI_Rn01_00052695 predicted 471
7 SASI_Rn01_00052696 predicted 590
8 SASI_Rn02_00204893 predicted 694
9 SASI_Rn01_00052698 predicted 446
10 SASI_Rn02_00204894 predicted 889
11 SASI_Rn01_00052690 predicted 684
12 SASI_Rn01_00052697 predicted 367
13 SASI_Rn01_00052699 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310585 predicted 486
2 SASI_Rn02_00310586 predicted 3317
3 SASI_Rn02_00310587 predicted 722
4 SASI_Rn02_00310588 predicted 3827
5 SASI_Rn02_00310589 predicted 1283
6 SASI_Rn02_00310590 predicted 782
7 SASI_Rn02_00310591 predicted 646
8 SASI_Rn02_00310592 predicted 3786
9 SASI_Rn02_00310593 predicted 1236
10 SASI_Rn02_00310594 predicted 2191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374211 predicted 4122
2 SASI_Rn02_00374212 predicted 3974
3 SASI_Rn02_00374213 predicted 3705
4 SASI_Rn02_00374214 predicted 3912
5 SASI_Rn02_00374215 predicted 3873
6 SASI_Rn02_00374216 predicted 3714
7 SASI_Rn02_00374217 predicted 3841
8 SASI_Rn02_00374218 predicted 4146
9 SASI_Rn02_00374219 predicted 3935
10 SASI_Rn02_00374220 predicted 3692
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447303 predicted 1525
2 SASI_Mm02_00447304 predicted 3640
3 SASI_Mm02_00447305 predicted 2981
4 SASI_Mm02_00447306 predicted 3299
5 SASI_Mm02_00447307 predicted 730
6 SASI_Mm02_00447308 predicted 721
7 SASI_Mm02_00447309 predicted 3390
8 SASI_Mm02_00447310 predicted 854
9 SASI_Mm02_00447311 predicted 1307
10 SASI_Mm02_00447312 predicted 3379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012414
VALIDATED
RAB3GAP2 MISSION shRNA Bacterial Glycerol Stock
RAB3 GTPase activating protein subunit 2 (non-catalytic)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012414.3-2101s21c1
Sequence:CCGGATGAGTCTGTCAGTCAATTAACTCGAGTTAATTGACTGACAGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012414.3-962s21c1
Sequence:CCGGTCATGCTAGTGTTGGTATTATCTCGAGATAATACCAACACTAGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012414.3-5711s21c1
Sequence:CCGGGTATGTCCTTCAGGGATATAACTCGAGTTATATCCCTGAAGGACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012414.3-2985s21c1
Sequence:CCGGAGTGTAGCCAAGTGGATATTTCTCGAGAAATATCCACTTGGCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-923s1c1
Sequence:CCGGGCCTCCAATATAGGTGGATTTCTCGAGAAATCCACCTATATTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-1561s1c1
Sequence:CCGGGCTGCTGTATCCTGGCTATAACTCGAGTTATAGCCAGGATACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012414.2-291s1c1
Sequence:CCGGCCTGGCTCCAAGATTGTGTTTCTCGAGAAACACAATCTTGGAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_012414.2-3275s1c1
Sequence:CCGGGCTGCTACATACTTAATGGATCTCGAGATCCATTAAGTATGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-1351s1c1
Sequence:CCGGCGACGCACAAATTGGATGGATCTCGAGATCCATCCAATTTGTGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012414.3-1155s21c1
Sequence:CCGGGCACTAGCAGTTGCAAGTAAACTCGAGTTTACTTGCAACTGCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012414
VALIDATED
RAB3GAP2 MISSION shRNA shRNA Plasmid DNA
RAB3 GTPase activating protein subunit 2 (non-catalytic)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012414.3-2101s21c1
Sequence:CCGGATGAGTCTGTCAGTCAATTAACTCGAGTTAATTGACTGACAGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012414.3-962s21c1
Sequence:CCGGTCATGCTAGTGTTGGTATTATCTCGAGATAATACCAACACTAGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012414.3-5711s21c1
Sequence:CCGGGTATGTCCTTCAGGGATATAACTCGAGTTATATCCCTGAAGGACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012414.3-2985s21c1
Sequence:CCGGAGTGTAGCCAAGTGGATATTTCTCGAGAAATATCCACTTGGCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-923s1c1
Sequence:CCGGGCCTCCAATATAGGTGGATTTCTCGAGAAATCCACCTATATTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-1561s1c1
Sequence:CCGGGCTGCTGTATCCTGGCTATAACTCGAGTTATAGCCAGGATACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012414.2-291s1c1
Sequence:CCGGCCTGGCTCCAAGATTGTGTTTCTCGAGAAACACAATCTTGGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_012414.2-3275s1c1
Sequence:CCGGGCTGCTACATACTTAATGGATCTCGAGATCCATTAAGTATGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-1351s1c1
Sequence:CCGGCGACGCACAAATTGGATGGATCTCGAGATCCATCCAATTTGTGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012414.3-1155s21c1
Sequence:CCGGGCACTAGCAGTTGCAAGTAAACTCGAGTTTACTTGCAACTGCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012414
VALIDATED
RAB3GAP2 MISSION shRNA Lentiviral Transduction Particles
RAB3 GTPase activating protein subunit 2 (non-catalytic)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012414.3-2101s21c1
Sequence:CCGGATGAGTCTGTCAGTCAATTAACTCGAGTTAATTGACTGACAGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012414.3-962s21c1
Sequence:CCGGTCATGCTAGTGTTGGTATTATCTCGAGATAATACCAACACTAGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012414.3-5711s21c1
Sequence:CCGGGTATGTCCTTCAGGGATATAACTCGAGTTATATCCCTGAAGGACATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012414.3-2985s21c1
Sequence:CCGGAGTGTAGCCAAGTGGATATTTCTCGAGAAATATCCACTTGGCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-923s1c1
Sequence:CCGGGCCTCCAATATAGGTGGATTTCTCGAGAAATCCACCTATATTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-1561s1c1
Sequence:CCGGGCTGCTGTATCCTGGCTATAACTCGAGTTATAGCCAGGATACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012414.2-291s1c1
Sequence:CCGGCCTGGCTCCAAGATTGTGTTTCTCGAGAAACACAATCTTGGAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_012414.2-3275s1c1
Sequence:CCGGGCTGCTACATACTTAATGGATCTCGAGATCCATTAAGTATGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012414.2-1351s1c1
Sequence:CCGGCGACGCACAAATTGGATGGATCTCGAGATCCATCCAATTTGTGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012414.3-1155s21c1
Sequence:CCGGGCACTAGCAGTTGCAAGTAAACTCGAGTTTACTTGCAACTGCTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)