EMAIL THIS PAGE TO A FRIEND

RAB3IL1

RAB3A interacting protein (rabin3)-like 1

98 Gene Product Result for
Synonyms: GRAB
UniProtKB ID: Q8TBN0, Q86V32, Q9P1Q8
Gene ID:
Human(5866) Summary: This gene encodes a guanine nucleotide exchange factor for the ras-related protein Rab3A. The encoded protein binds Rab3a and the inositol hexakisphosphate kinase InsP6K1. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2012]
Mouse(74760) RAB3A interacting protein (rabin3)-like 1
Rat(171452) RAB3A interacting protein (rabin3)-like 1
chicken(423123) RAB3A interacting protein (rabin3)-like 1
domestic cat(101084651) RAB3A interacting protein (rabin3)-like 1
dog(612267) RAB3A interacting protein (rabin3)-like 1
cow(614335) RAB3A interacting protein (rabin3)-like 1
sheep(101109571) RAB3A interacting protein (rabin3)-like 1
naked mole-rat(101723992) RAB3A interacting protein (rabin3)-like 1
domestic guinea pig(100722881) RAB3A interacting protein (rabin3)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013401 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013401 Rosetta Predictions human pricing
NM_134411 Rosetta Predictions rat pricing
NM_144538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085773 predicted 485
2 SASI_Hs02_00344783 predicted 411
3 SASI_Hs01_00085774 predicted 413
4 SASI_Hs01_00085775 predicted 799
5 SASI_Hs01_00085777 predicted 614
6 SASI_Hs01_00085779 predicted 1026
7 SASI_Hs01_00085780 predicted 1228
8 SASI_Hs01_00085781 predicted 1468
9 SASI_Hs01_00085782 predicted 1032
10 SASI_Hs02_00344784 predicted 455
11 SASI_Hs01_00085776 predicted 622
12 SASI_Hs01_00085778 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036433 predicted 362
2 SASI_Rn01_00036434 predicted 696
3 SASI_Rn01_00036435 predicted 256
4 SASI_Rn01_00036436 predicted 461
5 SASI_Rn01_00036437 predicted 456
6 SASI_Rn01_00036439 predicted 681
7 SASI_Rn01_00036440 predicted 843
8 SASI_Rn01_00036441 predicted 850
9 SASI_Rn01_00036442 predicted 689
10 SASI_Rn02_00268007 predicted 272
11 SASI_Rn01_00036438 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149520 predicted 483
2 SASI_Mm01_00149521 predicted 789
3 SASI_Mm01_00149522 predicted 1126
4 SASI_Mm01_00149523 predicted 402
5 SASI_Mm01_00149524 predicted 472
6 SASI_Mm01_00149525 predicted 1514
7 SASI_Mm01_00149526 predicted 1471
8 SASI_Mm01_00149527 predicted 1136
9 SASI_Mm01_00149528 predicted 1378
10 SASI_Mm01_00149529 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144538
RAB3IL1 MISSION shRNA Bacterial Glycerol Stock
RAB3A interacting protein (rabin3)-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-1098s1c1
Sequence:CCGGGTATGCAACTTCTTCACCTATCTCGAGATAGGTGAAGAAGTTGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-1106s1c1
Sequence:CCGGCTTCTTCACCTATATTCGCTACTCGAGTAGCGAATATAGGTGAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-962s1c1
Sequence:CCGGGCCCACTGTTGAGTGTAACAACTCGAGTTGTTACACTCAACAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144538.1-1895s1c1
Sequence:CCGGGCAATGTCAATATCCATCCATCTCGAGATGGATGGATATTGACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-354s1c1
Sequence:CCGGGAGCTGAAGCTAAAGGATGAACTCGAGTTCATCCTTTAGCTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144538
RAB3IL1 MISSION shRNA shRNA Plasmid DNA
RAB3A interacting protein (rabin3)-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-1098s1c1
Sequence:CCGGGTATGCAACTTCTTCACCTATCTCGAGATAGGTGAAGAAGTTGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-1106s1c1
Sequence:CCGGCTTCTTCACCTATATTCGCTACTCGAGTAGCGAATATAGGTGAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-962s1c1
Sequence:CCGGGCCCACTGTTGAGTGTAACAACTCGAGTTGTTACACTCAACAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144538.1-1895s1c1
Sequence:CCGGGCAATGTCAATATCCATCCATCTCGAGATGGATGGATATTGACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-354s1c1
Sequence:CCGGGAGCTGAAGCTAAAGGATGAACTCGAGTTCATCCTTTAGCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144538
RAB3IL1 MISSION shRNA Lentiviral Transduction Particles
RAB3A interacting protein (rabin3)-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-1098s1c1
Sequence:CCGGGTATGCAACTTCTTCACCTATCTCGAGATAGGTGAAGAAGTTGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-1106s1c1
Sequence:CCGGCTTCTTCACCTATATTCGCTACTCGAGTAGCGAATATAGGTGAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-962s1c1
Sequence:CCGGGCCCACTGTTGAGTGTAACAACTCGAGTTGTTACACTCAACAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144538.1-1895s1c1
Sequence:CCGGGCAATGTCAATATCCATCCATCTCGAGATGGATGGATATTGACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144538.1-354s1c1
Sequence:CCGGGAGCTGAAGCTAAAGGATGAACTCGAGTTCATCCTTTAGCTTCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013401
RAB3IL1 MISSION shRNA Bacterial Glycerol Stock
RAB3A interacting protein (rabin3)-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-1169s1c1
Sequence:CCGGGTGCAACTTCTTCACCTACATCTCGAGATGTAGGTGAAGAAGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-426s1c1
Sequence:CCGGCTGAAGCTAAAGGACGAGGAACTCGAGTTCCTCGTCCTTTAGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1178s1c1
Sequence:CCGGCTTCACCTACATCCGCTACATCTCGAGATGTAGCGGATGTAGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-431s1c1
Sequence:CCGGGCTAAAGGACGAGGAATGTGACTCGAGTCACATTCCTCGTCCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013401.2-1681s1c1
Sequence:CCGGGCTTGTCTTCAGAAAGGGACTCTCGAGAGTCCCTTTCTGAAGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-1123s1c1
Sequence:CCGGGCCATTACTACATCTCGCCATCTCGAGATGGCGAGATGTAGTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-516s1c1
Sequence:CCGGGAGGAAGCTCACAAGATGGTTCTCGAGAACCATCTTGTGAGCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-509s1c1
Sequence:CCGGCCTGTTTGAGGAAGCTCACAACTCGAGTTGTGAGCTTCCTCAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1235s1c1
Sequence:CCGGGTTCTGGGAGATCATGAGGTTCTCGAGAACCTCATGATCTCCCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-821s1c1
Sequence:CCGGCACAATCCTGTTTGCAGAGTTCTCGAGAACTCTGCAAACAGGATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1125s1c1
Sequence:CCGGCATTACTACATCTCGCCATCTCTCGAGAGATGGCGAGATGTAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013401.2-1864s1c1
Sequence:CCGGCCTTGTTAAGATGAGTCAAGACTCGAGTCTTGACTCATCTTAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013401
RAB3IL1 MISSION shRNA shRNA Plasmid DNA
RAB3A interacting protein (rabin3)-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-1169s1c1
Sequence:CCGGGTGCAACTTCTTCACCTACATCTCGAGATGTAGGTGAAGAAGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-426s1c1
Sequence:CCGGCTGAAGCTAAAGGACGAGGAACTCGAGTTCCTCGTCCTTTAGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1178s1c1
Sequence:CCGGCTTCACCTACATCCGCTACATCTCGAGATGTAGCGGATGTAGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-431s1c1
Sequence:CCGGGCTAAAGGACGAGGAATGTGACTCGAGTCACATTCCTCGTCCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013401.2-1681s1c1
Sequence:CCGGGCTTGTCTTCAGAAAGGGACTCTCGAGAGTCCCTTTCTGAAGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-1123s1c1
Sequence:CCGGGCCATTACTACATCTCGCCATCTCGAGATGGCGAGATGTAGTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-516s1c1
Sequence:CCGGGAGGAAGCTCACAAGATGGTTCTCGAGAACCATCTTGTGAGCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-509s1c1
Sequence:CCGGCCTGTTTGAGGAAGCTCACAACTCGAGTTGTGAGCTTCCTCAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1235s1c1
Sequence:CCGGGTTCTGGGAGATCATGAGGTTCTCGAGAACCTCATGATCTCCCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-821s1c1
Sequence:CCGGCACAATCCTGTTTGCAGAGTTCTCGAGAACTCTGCAAACAGGATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1125s1c1
Sequence:CCGGCATTACTACATCTCGCCATCTCTCGAGAGATGGCGAGATGTAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013401.2-1864s1c1
Sequence:CCGGCCTTGTTAAGATGAGTCAAGACTCGAGTCTTGACTCATCTTAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013401
RAB3IL1 MISSION shRNA Lentiviral Transduction Particles
RAB3A interacting protein (rabin3)-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-1169s1c1
Sequence:CCGGGTGCAACTTCTTCACCTACATCTCGAGATGTAGGTGAAGAAGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-426s1c1
Sequence:CCGGCTGAAGCTAAAGGACGAGGAACTCGAGTTCCTCGTCCTTTAGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1178s1c1
Sequence:CCGGCTTCACCTACATCCGCTACATCTCGAGATGTAGCGGATGTAGGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-431s1c1
Sequence:CCGGGCTAAAGGACGAGGAATGTGACTCGAGTCACATTCCTCGTCCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013401.2-1681s1c1
Sequence:CCGGGCTTGTCTTCAGAAAGGGACTCTCGAGAGTCCCTTTCTGAAGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-1123s1c1
Sequence:CCGGGCCATTACTACATCTCGCCATCTCGAGATGGCGAGATGTAGTAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013401.2-516s1c1
Sequence:CCGGGAGGAAGCTCACAAGATGGTTCTCGAGAACCATCTTGTGAGCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-509s1c1
Sequence:CCGGCCTGTTTGAGGAAGCTCACAACTCGAGTTGTGAGCTTCCTCAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1235s1c1
Sequence:CCGGGTTCTGGGAGATCATGAGGTTCTCGAGAACCTCATGATCTCCCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-821s1c1
Sequence:CCGGCACAATCCTGTTTGCAGAGTTCTCGAGAACTCTGCAAACAGGATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013401.2-1125s1c1
Sequence:CCGGCATTACTACATCTCGCCATCTCTCGAGAGATGGCGAGATGTAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013401.2-1864s1c1
Sequence:CCGGCCTTGTTAAGATGAGTCAAGACTCGAGTCTTGACTCATCTTAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)