EMAIL THIS PAGE TO A FRIEND

RAB41

RAB41, member RAS oncogene family

19 Gene Product Result for
Species: Human RAB41(347517)
UniProtKB ID: Q5JT25, Q17RQ0
Gene ID:
Human(347517) Summary: This gene encodes a small GTP-binding protein that belongs to the largest family within the Ras superfamily. These proteins function as regulators of membrane trafficking. They cycle between inactive GDP-bound and activated GTP-bound states, which is controlled by GTP hydrolysis-activating proteins (GAPs). This family member can be activated by the GAP protein RN-Tre, and it is localized to the Golgi complex. [provided by RefSeq, May 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001032726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032726 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032726 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070353 predicted 360
2 SASI_Hs01_00070355 predicted 218
3 SASI_Hs01_00070356 predicted 458
4 SASI_Hs01_00070357 predicted 389
5 SASI_Hs01_00070360 predicted 607
6 SASI_Hs01_00070361 predicted 648
7 SASI_Hs01_00070362 predicted 546
8 SASI_Hs02_00307955 predicted 647
9 SASI_Hs02_00307956 predicted 626
10 SASI_Hs02_00307957 predicted 649
11 SASI_Hs01_00070354 predicted 492
12 SASI_Hs01_00070358 predicted 430
13 SASI_Hs01_00070359 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032726
RAB41 MISSION shRNA Bacterial Glycerol Stock
RAB41, member RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032726.1-272s21c1
Sequence:GTACCGGAGCGCTTTCACAGCCTAATTCCTCGAGGAATTAGGCTGTGAAAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032726.1-423s21c1
Sequence:GTACCGGGTTGGGTAACAAGATTGATTTCTCGAGAAATCAATCTTGTTACCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-643s1c1
Sequence:CCGGGAGTCAGGCAACAGAAGCTATCTCGAGATAGCTTCTGTTGCCTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-647s1c1
Sequence:CCGGCAGGCAACAGAAGCTATTGTTCTCGAGAACAATAGCTTCTGTTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-232s1c1
Sequence:CCGGCAAATAGTTCAGCTGCAGCTACTCGAGTAGCTGCAGCTGAACTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-363s1c1
Sequence:CCGGGACAGATAAGTGGGTAGAACACTCGAGTGTTCTACCCACTTATCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-78s1c1
Sequence:CCGGCCAGTCTCTGTGCAAATCTAACTCGAGTTAGATTTGCACAGAGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-405s1c1
Sequence:CCGGCGATGTTGTCATCATGTTGTTCTCGAGAACAACATGATGACAACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-414s1c1
Sequence:CCGGCATCATGTTGTTGGGTAACAACTCGAGTTGTTACCCAACAACATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-307s1c1
Sequence:CCGGGATTCAACTATTGCAGTGGTTCTCGAGAACCACTGCAATAGTTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032726.1-683s1c1
Sequence:CCGGCTCTGCCTCATTTGATGGATTCTCGAGAATCCATCAAATGAGGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032726
RAB41 MISSION shRNA shRNA Plasmid DNA
RAB41, member RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032726.1-272s21c1
Sequence:GTACCGGAGCGCTTTCACAGCCTAATTCCTCGAGGAATTAGGCTGTGAAAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032726.1-423s21c1
Sequence:GTACCGGGTTGGGTAACAAGATTGATTTCTCGAGAAATCAATCTTGTTACCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-643s1c1
Sequence:CCGGGAGTCAGGCAACAGAAGCTATCTCGAGATAGCTTCTGTTGCCTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-647s1c1
Sequence:CCGGCAGGCAACAGAAGCTATTGTTCTCGAGAACAATAGCTTCTGTTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-232s1c1
Sequence:CCGGCAAATAGTTCAGCTGCAGCTACTCGAGTAGCTGCAGCTGAACTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-363s1c1
Sequence:CCGGGACAGATAAGTGGGTAGAACACTCGAGTGTTCTACCCACTTATCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-78s1c1
Sequence:CCGGCCAGTCTCTGTGCAAATCTAACTCGAGTTAGATTTGCACAGAGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-405s1c1
Sequence:CCGGCGATGTTGTCATCATGTTGTTCTCGAGAACAACATGATGACAACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-414s1c1
Sequence:CCGGCATCATGTTGTTGGGTAACAACTCGAGTTGTTACCCAACAACATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-307s1c1
Sequence:CCGGGATTCAACTATTGCAGTGGTTCTCGAGAACCACTGCAATAGTTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032726.1-683s1c1
Sequence:CCGGCTCTGCCTCATTTGATGGATTCTCGAGAATCCATCAAATGAGGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032726
RAB41 MISSION shRNA Lentiviral Transduction Particles
RAB41, member RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032726.1-272s21c1
Sequence:GTACCGGAGCGCTTTCACAGCCTAATTCCTCGAGGAATTAGGCTGTGAAAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001032726.1-423s21c1
Sequence:GTACCGGGTTGGGTAACAAGATTGATTTCTCGAGAAATCAATCTTGTTACCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-643s1c1
Sequence:CCGGGAGTCAGGCAACAGAAGCTATCTCGAGATAGCTTCTGTTGCCTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-647s1c1
Sequence:CCGGCAGGCAACAGAAGCTATTGTTCTCGAGAACAATAGCTTCTGTTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-232s1c1
Sequence:CCGGCAAATAGTTCAGCTGCAGCTACTCGAGTAGCTGCAGCTGAACTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-363s1c1
Sequence:CCGGGACAGATAAGTGGGTAGAACACTCGAGTGTTCTACCCACTTATCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-78s1c1
Sequence:CCGGCCAGTCTCTGTGCAAATCTAACTCGAGTTAGATTTGCACAGAGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-405s1c1
Sequence:CCGGCGATGTTGTCATCATGTTGTTCTCGAGAACAACATGATGACAACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-414s1c1
Sequence:CCGGCATCATGTTGTTGGGTAACAACTCGAGTTGTTACCCAACAACATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001032726.1-307s1c1
Sequence:CCGGGATTCAACTATTGCAGTGGTTCTCGAGAACCACTGCAATAGTTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001032726.1-683s1c1
Sequence:CCGGCTCTGCCTCATTTGATGGATTCTCGAGAATCCATCAAATGAGGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)