EMAIL THIS PAGE TO A FRIEND

RAB42

RAB42, member RAS oncogene family

44 Gene Product Result for
Synonyms: RP4-669K10.6
UniProtKB ID: Q8N4Z0, B2R5G2
Gene ID:
Mouse(242681) RAB42, member RAS oncogene family
dog(487331) RAB42, member RAS oncogene family
domestic cat(101091885) RAB42, member RAS oncogene family
cow(514286) RAB42, member RAS oncogene family
sheep(101109867) RAB42, member RAS oncogene family
naked mole-rat(101719380) RAB42, member RAS oncogene family
domestic guinea pig(100718215) RAB42, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152304 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020481 MISSION® esiRNA esiRNA human RAB42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152304 Rosetta Predictions human pricing
NM_001081651 Rosetta Predictions mouse pricing
XM_144080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038276 predicted 470
2 SASI_Hs02_00365873 predicted 544
3 SASI_Hs02_00365874 predicted 538
4 SASI_Hs02_00365875 predicted 546
5 SASI_Hs01_00038277 predicted 469
6 SASI_Hs02_00365876 predicted 429
7 SASI_Hs02_00365877 predicted 455
8 SASI_Hs02_00365878 predicted 458
9 SASI_Hs01_00038278 predicted 477
10 SASI_Hs01_00038279 predicted 465
11 SASI_Hs01_00038280 predicted 470
12 SASI_Hs01_00038281 predicted 767
13 SASI_Hs01_00038282 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298793 predicted 392
2 SASI_Mm02_00298794 predicted 303
3 SASI_Mm02_00298795 predicted 450
4 SASI_Mm02_00298796 predicted 401
5 SASI_Mm02_00298797 predicted 414
6 SASI_Mm02_00298798 predicted 308
7 SASI_Mm02_00298799 predicted 240
8 SASI_Mm02_00298800 predicted 381
9 SASI_Mm02_00298801 predicted 359
10 SASI_Mm02_00298802 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254230 predicted 279
2 SASI_Mm01_00254231 predicted 277
3 SASI_Mm01_00254232 predicted 278
4 SASI_Mm01_00254233 predicted 283
5 SASI_Mm01_00254234 predicted 272
6 SASI_Mm01_00254235 predicted 234
7 SASI_Mm01_00254236 predicted 281
8 SASI_Mm01_00254237 predicted 277
9 SASI_Mm01_00254238 predicted 238
10 SASI_Mm01_00254239 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152304
RAB42 MISSION shRNA Bacterial Glycerol Stock
RAB42, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-602s21c1
Sequence:GTACCGGACTCAGGCCCATGCCAGTGTTCTCGAGAACACTGGCATGGGCCTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152304.1-716s21c1
Sequence:GTACCGGAGGGTTCATATAAACAGTATCCTCGAGGATACTGTTTATATGAACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-428s21c1
Sequence:GTACCGGCCTTCGTGGAGACCTCGGTTACTCGAGTAACCGAGGTCTCCACGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-452s21c1
Sequence:GTACCGGACAACTGCAATGTGGACCTGGCTCGAGCCAGGTCCACATTGCAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-477s21c1
Sequence:GTACCGGTGACACCCTCGCTGATGCTATCTCGAGATAGCATCAGCGAGGGTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-353s21c1
Sequence:GTACCGGACAAGAGTGACCTGCAGAGCACTCGAGTGCTCTGCAGGTCACTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152304.1-734s21c1
Sequence:GTACCGGATCCTGACACAGTCATGCTTCCTCGAGGAAGCATGACTGTGTCAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-548s21c1
Sequence:GTACCGGGTGTCCGGCTCATCCACAAGACTCGAGTCTTGTGGATGAGCCGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-555s1c1
Sequence:CCGGGCTCATCCACAAGACCCAAATCTCGAGATTTGGGTCTTGTGGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-472s1c1
Sequence:CCGGGCCTTTGACACCCTCGCTGATCTCGAGATCAGCGAGGGTGTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-429s1c1
Sequence:CCGGCTTCGTGGAGACCTCGGTTAACTCGAGTTAACCGAGGTCTCCACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-336s1c1
Sequence:CCGGCTTCCTGCTGGTTGGCCACAACTCGAGTTGTGGCCAACCAGCAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-586s1c1
Sequence:CCGGCCCAGCAGGAAGCAGCACTCACTCGAGTGAGTGCTGCTTCCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152304
RAB42 MISSION shRNA shRNA Plasmid DNA
RAB42, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-602s21c1
Sequence:GTACCGGACTCAGGCCCATGCCAGTGTTCTCGAGAACACTGGCATGGGCCTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152304.1-716s21c1
Sequence:GTACCGGAGGGTTCATATAAACAGTATCCTCGAGGATACTGTTTATATGAACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-428s21c1
Sequence:GTACCGGCCTTCGTGGAGACCTCGGTTACTCGAGTAACCGAGGTCTCCACGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-452s21c1
Sequence:GTACCGGACAACTGCAATGTGGACCTGGCTCGAGCCAGGTCCACATTGCAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-477s21c1
Sequence:GTACCGGTGACACCCTCGCTGATGCTATCTCGAGATAGCATCAGCGAGGGTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-353s21c1
Sequence:GTACCGGACAAGAGTGACCTGCAGAGCACTCGAGTGCTCTGCAGGTCACTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152304.1-734s21c1
Sequence:GTACCGGATCCTGACACAGTCATGCTTCCTCGAGGAAGCATGACTGTGTCAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-548s21c1
Sequence:GTACCGGGTGTCCGGCTCATCCACAAGACTCGAGTCTTGTGGATGAGCCGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-555s1c1
Sequence:CCGGGCTCATCCACAAGACCCAAATCTCGAGATTTGGGTCTTGTGGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-472s1c1
Sequence:CCGGGCCTTTGACACCCTCGCTGATCTCGAGATCAGCGAGGGTGTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-429s1c1
Sequence:CCGGCTTCGTGGAGACCTCGGTTAACTCGAGTTAACCGAGGTCTCCACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-336s1c1
Sequence:CCGGCTTCCTGCTGGTTGGCCACAACTCGAGTTGTGGCCAACCAGCAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-586s1c1
Sequence:CCGGCCCAGCAGGAAGCAGCACTCACTCGAGTGAGTGCTGCTTCCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152304
RAB42 MISSION shRNA Lentiviral Transduction Particles
RAB42, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-602s21c1
Sequence:GTACCGGACTCAGGCCCATGCCAGTGTTCTCGAGAACACTGGCATGGGCCTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152304.1-716s21c1
Sequence:GTACCGGAGGGTTCATATAAACAGTATCCTCGAGGATACTGTTTATATGAACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-428s21c1
Sequence:GTACCGGCCTTCGTGGAGACCTCGGTTACTCGAGTAACCGAGGTCTCCACGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-452s21c1
Sequence:GTACCGGACAACTGCAATGTGGACCTGGCTCGAGCCAGGTCCACATTGCAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-477s21c1
Sequence:GTACCGGTGACACCCTCGCTGATGCTATCTCGAGATAGCATCAGCGAGGGTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-353s21c1
Sequence:GTACCGGACAAGAGTGACCTGCAGAGCACTCGAGTGCTCTGCAGGTCACTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152304.1-734s21c1
Sequence:GTACCGGATCCTGACACAGTCATGCTTCCTCGAGGAAGCATGACTGTGTCAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152304.1-548s21c1
Sequence:GTACCGGGTGTCCGGCTCATCCACAAGACTCGAGTCTTGTGGATGAGCCGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-555s1c1
Sequence:CCGGGCTCATCCACAAGACCCAAATCTCGAGATTTGGGTCTTGTGGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-472s1c1
Sequence:CCGGGCCTTTGACACCCTCGCTGATCTCGAGATCAGCGAGGGTGTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-429s1c1
Sequence:CCGGCTTCGTGGAGACCTCGGTTAACTCGAGTTAACCGAGGTCTCCACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-336s1c1
Sequence:CCGGCTTCCTGCTGGTTGGCCACAACTCGAGTTGTGGCCAACCAGCAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152304.1-586s1c1
Sequence:CCGGCCCAGCAGGAAGCAGCACTCACTCGAGTGAGTGCTGCTTCCTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081651
RAB42 MISSION shRNA Bacterial Glycerol Stock
RAB42, member RAS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-408s21c1
Sequence:CCGGACCTGAACACCCGATGCGTATCTCGAGATACGCATCGGGTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-279s21c1
Sequence:CCGGTGGGCGTTCTGTTGGTCTTTGCTCGAGCAAAGACCAACAGAACGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-303s21c1
Sequence:CCGGTGACGAACAGAGAGTCCTTTGCTCGAGCAAAGGACTCTCTGTTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-369s21c1
Sequence:CCGGCTGACAAGGTGGTCTTCTTACCTCGAGGTAAGAAGACCACCTTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-86s21c1
Sequence:CCGGACGTCACTGCTACGGTGTTACCTCGAGGTAACACCGTAGCAGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081651
RAB42 MISSION shRNA shRNA Plasmid DNA
RAB42, member RAS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-408s21c1
Sequence:CCGGACCTGAACACCCGATGCGTATCTCGAGATACGCATCGGGTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-279s21c1
Sequence:CCGGTGGGCGTTCTGTTGGTCTTTGCTCGAGCAAAGACCAACAGAACGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-303s21c1
Sequence:CCGGTGACGAACAGAGAGTCCTTTGCTCGAGCAAAGGACTCTCTGTTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-369s21c1
Sequence:CCGGCTGACAAGGTGGTCTTCTTACCTCGAGGTAAGAAGACCACCTTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-86s21c1
Sequence:CCGGACGTCACTGCTACGGTGTTACCTCGAGGTAACACCGTAGCAGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081651
RAB42 MISSION shRNA Lentiviral Transduction Particles
RAB42, member RAS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-408s21c1
Sequence:CCGGACCTGAACACCCGATGCGTATCTCGAGATACGCATCGGGTGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-279s21c1
Sequence:CCGGTGGGCGTTCTGTTGGTCTTTGCTCGAGCAAAGACCAACAGAACGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-303s21c1
Sequence:CCGGTGACGAACAGAGAGTCCTTTGCTCGAGCAAAGGACTCTCTGTTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-369s21c1
Sequence:CCGGCTGACAAGGTGGTCTTCTTACCTCGAGGTAAGAAGACCACCTTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081651.1-86s21c1
Sequence:CCGGACGTCACTGCTACGGTGTTACCTCGAGGTAACACCGTAGCAGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)