EMAIL THIS PAGE TO A FRIEND

RAB43

RAB43, member RAS oncogene family

122 Gene Product Result for
Synonyms: RAB11B RAB41
UniProtKB ID: Q86YS6, A8K4P9
Gene ID:
Mouse(69834) RAB43, member RAS oncogene family
Rat(500249) RAB43, member RAS oncogene family
Zebrafish(570205) RAB43, member RAS oncogene family
chicken(415970) RAB43, member RAS oncogene family
domestic cat(101087214) RAB43, member RAS oncogene family
domestic guinea pig(100719282) RAB43, member RAS oncogene family
naked mole-rat(101718589) RAB43, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198490 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198490 Rosetta Predictions human pricing
NM_001024331 Rosetta Predictions rat pricing
NM_001039394 Rosetta Predictions mouse pricing
NM_133717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021040 predicted 612
2 SASI_Hs01_00021041 predicted 631
3 SASI_Hs01_00021042 predicted 563
4 SASI_Hs01_00021043 predicted 753
5 SASI_Hs02_00372056 predicted 375
6 SASI_Hs01_00021044 predicted 639
7 SASI_Hs01_00021045 predicted 1362
8 SASI_Hs01_00021046 predicted 425
9 SASI_Hs01_00021047 predicted 535
10 SASI_Hs01_00021048 predicted 1317
11 SASI_Hs01_00021049 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090400 predicted 299
2 SASI_Rn01_00090401 predicted 253
3 SASI_Rn01_00090402 predicted 339
4 SASI_Rn01_00090403 predicted 489
5 SASI_Rn01_00090404 predicted 203
6 SASI_Rn01_00090405 predicted 374
7 SASI_Rn01_00090406 predicted 478
8 SASI_Rn01_00090408 predicted 481
9 SASI_Rn02_00202553 predicted 268
10 SASI_Rn01_00090409 predicted 456
11 SASI_Rn01_00090407 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165814 predicted 1282
2 SASI_Mm01_00165815 predicted 1057
3 SASI_Mm01_00165816 predicted 1083
4 SASI_Mm01_00165817 predicted 1346
5 SASI_Mm01_00165818 predicted 989
6 SASI_Mm01_00165819 predicted 631
7 SASI_Mm01_00165820 predicted 1234
8 SASI_Mm01_00165821 predicted 977
9 SASI_Mm01_00165822 predicted 1053
10 SASI_Mm01_00165823 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032763 predicted 981
2 SASI_Mm01_00032764 predicted 757
3 SASI_Mm01_00032765 predicted 787
4 SASI_Mm01_00032766 predicted 1049
5 SASI_Mm01_00032767 predicted 690
6 SASI_Mm01_00032768 predicted 339
7 SASI_Mm01_00032769 predicted 931
8 SASI_Mm01_00032770 predicted 685
9 SASI_Mm01_00032771 predicted 750
10 SASI_Mm01_00032772 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133717
VALIDATED
RAB43 MISSION shRNA Bacterial Glycerol Stock
RAB43, member RAS oncogene family
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-127s21c1
Sequence:GTACCGGATTGTTACTGTTACAGATTTGCTCGAGCAAATCTGTAACAGTAACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-268s21c1
Sequence:CCGGGATCGAGGATGTGAGGAAGTACTCGAGTACTTCCTCACATCCTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-324s21c1
Sequence:CCGGACAAGTCAGACCTTGCCGATTCTCGAGAATCGGCAAGGTCTGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-383s21c1
Sequence:CCGGGAGCACTATGACATCCTCTGTCTCGAGACAGAGGATGTCATAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-962s21c1
Sequence:CCGGCCTGCCTCTTACCAAAGTATACTCGAGTATACTTTGGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-213s21c1
Sequence:GTACCGGCTATCCTTGCGTACGACATCACTCGAGTGATGTCGTACGCAAGGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-300s21c1
Sequence:GTACCGGACATCGTGCAGCTGCTGATTGCTCGAGCAATCAGCAGCTGCACGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-965s1c1
Sequence:CCGGCCTGCCTCTTACCAAAGTATACTCGAGTATACTTTGGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-386s1c1
Sequence:CCGGGAGCACTATGACATCCTCTGTCTCGAGACAGAGGATGTCATAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-327s1c1
Sequence:CCGGACAAGTCAGACCTTGCCGATTCTCGAGAATCGGCAAGGTCTGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-271s1c1
Sequence:CCGGGATCGAGGATGTGAGGAAGTACTCGAGTACTTCCTCACATCCTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-490s1c1
Sequence:CCGGAGGTCCCATGTTCAGTGAGAACTCGAGTTCTCACTGAACATGGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133717
VALIDATED
RAB43 MISSION shRNA shRNA Plasmid DNA
RAB43, member RAS oncogene family
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-127s21c1
Sequence:GTACCGGATTGTTACTGTTACAGATTTGCTCGAGCAAATCTGTAACAGTAACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-268s21c1
Sequence:CCGGGATCGAGGATGTGAGGAAGTACTCGAGTACTTCCTCACATCCTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-324s21c1
Sequence:CCGGACAAGTCAGACCTTGCCGATTCTCGAGAATCGGCAAGGTCTGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-383s21c1
Sequence:CCGGGAGCACTATGACATCCTCTGTCTCGAGACAGAGGATGTCATAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-962s21c1
Sequence:CCGGCCTGCCTCTTACCAAAGTATACTCGAGTATACTTTGGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-213s21c1
Sequence:GTACCGGCTATCCTTGCGTACGACATCACTCGAGTGATGTCGTACGCAAGGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-300s21c1
Sequence:GTACCGGACATCGTGCAGCTGCTGATTGCTCGAGCAATCAGCAGCTGCACGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-965s1c1
Sequence:CCGGCCTGCCTCTTACCAAAGTATACTCGAGTATACTTTGGTAAGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-386s1c1
Sequence:CCGGGAGCACTATGACATCCTCTGTCTCGAGACAGAGGATGTCATAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-327s1c1
Sequence:CCGGACAAGTCAGACCTTGCCGATTCTCGAGAATCGGCAAGGTCTGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-271s1c1
Sequence:CCGGGATCGAGGATGTGAGGAAGTACTCGAGTACTTCCTCACATCCTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-490s1c1
Sequence:CCGGAGGTCCCATGTTCAGTGAGAACTCGAGTTCTCACTGAACATGGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133717
VALIDATED
RAB43 MISSION shRNA Lentiviral Transduction Particles
RAB43, member RAS oncogene family
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-127s21c1
Sequence:GTACCGGATTGTTACTGTTACAGATTTGCTCGAGCAAATCTGTAACAGTAACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-268s21c1
Sequence:CCGGGATCGAGGATGTGAGGAAGTACTCGAGTACTTCCTCACATCCTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-324s21c1
Sequence:CCGGACAAGTCAGACCTTGCCGATTCTCGAGAATCGGCAAGGTCTGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-383s21c1
Sequence:CCGGGAGCACTATGACATCCTCTGTCTCGAGACAGAGGATGTCATAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133717.2-962s21c1
Sequence:CCGGCCTGCCTCTTACCAAAGTATACTCGAGTATACTTTGGTAAGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-213s21c1
Sequence:GTACCGGCTATCCTTGCGTACGACATCACTCGAGTGATGTCGTACGCAAGGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133717.2-300s21c1
Sequence:GTACCGGACATCGTGCAGCTGCTGATTGCTCGAGCAATCAGCAGCTGCACGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-965s1c1
Sequence:CCGGCCTGCCTCTTACCAAAGTATACTCGAGTATACTTTGGTAAGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-386s1c1
Sequence:CCGGGAGCACTATGACATCCTCTGTCTCGAGACAGAGGATGTCATAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-327s1c1
Sequence:CCGGACAAGTCAGACCTTGCCGATTCTCGAGAATCGGCAAGGTCTGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-271s1c1
Sequence:CCGGGATCGAGGATGTGAGGAAGTACTCGAGTACTTCCTCACATCCTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133717.1-490s1c1
Sequence:CCGGAGGTCCCATGTTCAGTGAGAACTCGAGTTCTCACTGAACATGGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198490
RAB43 MISSION shRNA Bacterial Glycerol Stock
RAB43, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-327s21c1
Sequence:CCGGCAGTACGATTTCCTGTTCAAGCTCGAGCTTGAACAGGAAATCGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-568s21c1
Sequence:CCGGCCATCCTTGCCTACGACATCACTCGAGTGATGTCGTAGGCAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198490.1-4272s21c1
Sequence:CCGGGCTTCAGTCAGCGCAAGTATTCTCGAGAATACTTGCGCTGACTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-442s21c1
Sequence:CCGGGCGTCGACTTCACCATGAAGACTCGAGTCTTCATGGTGAAGTCGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-323s1c1
Sequence:CCGGCGAGCAGTACGATTTCCTGTTCTCGAGAACAGGAAATCGTACTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-640s21c1
Sequence:CCGGAGTATGCGGGCTCCAACATTGCTCGAGCAATGTTGGAGCCCGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-317s1c1
Sequence:CCGGCCCGGACGAGCAGTACGATTTCTCGAGAAATCGTACTGCTCGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198490.1-1950s1c1
Sequence:CCGGGCACCAAAGTTAGAAGGCAAACTCGAGTTTGCCTTCTAACTTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-878s1c1
Sequence:CCGGCCAGCTGAACAGCAAGGACATCTCGAGATGTCCTTGCTGTTCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-326s1c1
Sequence:CCGGGCAGTACGATTTCCTGTTCAACTCGAGTTGAACAGGAAATCGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198490
RAB43 MISSION shRNA shRNA Plasmid DNA
RAB43, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-327s21c1
Sequence:CCGGCAGTACGATTTCCTGTTCAAGCTCGAGCTTGAACAGGAAATCGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-568s21c1
Sequence:CCGGCCATCCTTGCCTACGACATCACTCGAGTGATGTCGTAGGCAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198490.1-4272s21c1
Sequence:CCGGGCTTCAGTCAGCGCAAGTATTCTCGAGAATACTTGCGCTGACTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-442s21c1
Sequence:CCGGGCGTCGACTTCACCATGAAGACTCGAGTCTTCATGGTGAAGTCGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-323s1c1
Sequence:CCGGCGAGCAGTACGATTTCCTGTTCTCGAGAACAGGAAATCGTACTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-640s21c1
Sequence:CCGGAGTATGCGGGCTCCAACATTGCTCGAGCAATGTTGGAGCCCGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-317s1c1
Sequence:CCGGCCCGGACGAGCAGTACGATTTCTCGAGAAATCGTACTGCTCGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198490.1-1950s1c1
Sequence:CCGGGCACCAAAGTTAGAAGGCAAACTCGAGTTTGCCTTCTAACTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-878s1c1
Sequence:CCGGCCAGCTGAACAGCAAGGACATCTCGAGATGTCCTTGCTGTTCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-326s1c1
Sequence:CCGGGCAGTACGATTTCCTGTTCAACTCGAGTTGAACAGGAAATCGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198490
RAB43 MISSION shRNA Lentiviral Transduction Particles
RAB43, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-327s21c1
Sequence:CCGGCAGTACGATTTCCTGTTCAAGCTCGAGCTTGAACAGGAAATCGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-568s21c1
Sequence:CCGGCCATCCTTGCCTACGACATCACTCGAGTGATGTCGTAGGCAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198490.1-4272s21c1
Sequence:CCGGGCTTCAGTCAGCGCAAGTATTCTCGAGAATACTTGCGCTGACTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-442s21c1
Sequence:CCGGGCGTCGACTTCACCATGAAGACTCGAGTCTTCATGGTGAAGTCGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-323s1c1
Sequence:CCGGCGAGCAGTACGATTTCCTGTTCTCGAGAACAGGAAATCGTACTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198490.1-640s21c1
Sequence:CCGGAGTATGCGGGCTCCAACATTGCTCGAGCAATGTTGGAGCCCGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-317s1c1
Sequence:CCGGCCCGGACGAGCAGTACGATTTCTCGAGAAATCGTACTGCTCGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198490.1-1950s1c1
Sequence:CCGGGCACCAAAGTTAGAAGGCAAACTCGAGTTTGCCTTCTAACTTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-878s1c1
Sequence:CCGGCCAGCTGAACAGCAAGGACATCTCGAGATGTCCTTGCTGTTCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198490.1-326s1c1
Sequence:CCGGGCAGTACGATTTCCTGTTCAACTCGAGTTGAACAGGAAATCGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)