EMAIL THIS PAGE TO A FRIEND

RAB44

RAB44, member RAS oncogene family

79 Gene Product Result for
Synonyms: RASD3 RASL13 dJ431A14.3
UniProtKB ID: Q7Z6P3
Gene ID:
Mouse(442827) RAB44, member RAS oncogene family
Rat(309649) RAB44, member RAS oncogene family
Zebrafish(560799) RAB44, member RAS oncogene family
domestic cat(101092764) RAB44, member RAS oncogene family
dog(481767) RAB44, member RAS oncogene family
cow(100337049) RAB44, member RAS oncogene family
sheep(101102185) RAB44, member RAS oncogene family
naked mole-rat(101704901) RAB44, member RAS oncogene family
Domestic Rabbit(100341179) RAB44, member RAS oncogene family
domestic guinea pig(100722916) RAB44, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207498 Rosetta Predictions human pricing
XM_001722008 Rosetta Predictions human pricing
XM_001722068 Rosetta Predictions human pricing
XM_001725007 Rosetta Predictions human pricing
XM_001078666 Rosetta Predictions rat pricing
XM_228043 Rosetta Predictions rat pricing
NM_001002786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025345 predicted 603
2 SASI_Hs01_00025346 predicted 688
3 SASI_Hs01_00025347 predicted 518
4 SASI_Hs01_00025348 predicted 451
5 SASI_Hs01_00025349 predicted 1322
6 SASI_Hs01_00025350 predicted 666
7 SASI_Hs01_00025351 predicted 1176
8 SASI_Hs01_00025352 predicted 1184
9 SASI_Hs01_00025353 predicted 887
10 SASI_Hs01_00025354 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446517 predicted 472
2 SASI_Hs02_00446518 predicted 2514
3 SASI_Hs02_00446519 predicted 3569
4 SASI_Hs02_00446520 predicted 3241
5 SASI_Hs02_00446521 predicted 3386
6 SASI_Hs02_00446522 predicted 471
7 SASI_Hs02_00446523 predicted 377
8 SASI_Hs02_00446524 predicted 3732
9 SASI_Hs02_00446525 predicted 3267
10 SASI_Hs02_00446526 predicted 3389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446902 predicted 471
2 SASI_Hs02_00446903 predicted 2508
3 SASI_Hs02_00446904 predicted 3570
4 SASI_Hs02_00446905 predicted 3262
5 SASI_Hs02_00446906 predicted 3242
6 SASI_Hs02_00446907 predicted 3387
7 SASI_Hs02_00446908 predicted 477
8 SASI_Hs02_00446909 predicted 370
9 SASI_Hs02_00446910 predicted 3732
10 SASI_Hs02_00446911 predicted 3383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00464994 predicted 2109
2 SASI_Hs02_00464995 predicted 3598
3 SASI_Hs02_00464996 predicted 2779
4 SASI_Hs02_00464997 predicted 2097
5 SASI_Hs02_00464998 predicted 2154
6 SASI_Hs02_00464999 predicted 3605
7 SASI_Hs02_00465000 predicted 2610
8 SASI_Hs02_00465001 predicted 2697
9 SASI_Hs02_00465002 predicted 3575
10 SASI_Hs02_00465003 predicted 2802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361637 predicted 1124
2 SASI_Rn02_00361638 predicted 684
3 SASI_Rn02_00361639 predicted 2386
4 SASI_Rn02_00361640 predicted 296
5 SASI_Rn02_00361641 predicted 1319
6 SASI_Rn02_00361642 predicted 1140
7 SASI_Rn02_00361643 predicted 1787
8 SASI_Rn02_00361644 predicted 2674
9 SASI_Rn02_00361645 predicted 1590
10 SASI_Rn02_00361646 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384871 predicted 1187
2 SASI_Rn02_00384872 predicted 748
3 SASI_Rn02_00384873 predicted 2447
4 SASI_Rn02_00384874 predicted 352
5 SASI_Rn02_00384875 predicted 1855
6 SASI_Rn02_00384876 predicted 2742
7 SASI_Rn02_00384877 predicted 226
8 SASI_Rn02_00384878 predicted 243
9 SASI_Rn02_00384879 predicted 1649
10 SASI_Rn02_00384880 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171649 predicted 1704
2 SASI_Mm01_00171651 predicted 2823
3 SASI_Mm01_00171653 predicted 2108
4 SASI_Mm01_00171654 predicted 1465
5 SASI_Mm01_00171655 predicted 3162
6 SASI_Mm02_00286295 predicted 3271
7 SASI_Mm02_00286296 predicted 1567
8 SASI_Mm02_00286297 predicted 2748
9 SASI_Mm01_00171657 predicted 1574
10 SASI_Mm01_00171658 predicted 2265
11 SASI_Mm01_00171650 predicted 1731
12 SASI_Mm01_00171652 predicted 3349
13 SASI_Mm01_00171656 predicted 1626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207498
RAB44 MISSION shRNA Bacterial Glycerol Stock
RAB44, member RAS oncogene family
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1571s1c1
Sequence:CCGGGAATCATTCACACACTTCTATCTCGAGATAGAAGTGTGTGAATGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1262s1c1
Sequence:CCGGCCCTCGCTATTTCTATTTGCACTCGAGTGCAAATAGAAATAGCGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1621s1c1
Sequence:CCGGCCATAATATTCACCTCCTGAACTCGAGTTCAGGAGGTGAATATTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1182s1c1
Sequence:CCGGGTAACCTGTTAATCACATGTTCTCGAGAACATGTGATTAACAGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1267s1c1
Sequence:CCGGGCTATTTCTATTTGCAAGCATCTCGAGATGCTTGCAAATAGAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-933s1c1
Sequence:CCGGCCAAACAAAGAAAGTCTAGAACTCGAGTTCTAGACTTTCTTTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1165s1c1
Sequence:CCGGGCTGGCTCCTAATTAGTGTAACTCGAGTTACACTAATTAGGAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207498
RAB44 MISSION shRNA shRNA Plasmid DNA
RAB44, member RAS oncogene family
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1571s1c1
Sequence:CCGGGAATCATTCACACACTTCTATCTCGAGATAGAAGTGTGTGAATGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1262s1c1
Sequence:CCGGCCCTCGCTATTTCTATTTGCACTCGAGTGCAAATAGAAATAGCGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1621s1c1
Sequence:CCGGCCATAATATTCACCTCCTGAACTCGAGTTCAGGAGGTGAATATTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1182s1c1
Sequence:CCGGGTAACCTGTTAATCACATGTTCTCGAGAACATGTGATTAACAGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1267s1c1
Sequence:CCGGGCTATTTCTATTTGCAAGCATCTCGAGATGCTTGCAAATAGAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-933s1c1
Sequence:CCGGCCAAACAAAGAAAGTCTAGAACTCGAGTTCTAGACTTTCTTTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1165s1c1
Sequence:CCGGGCTGGCTCCTAATTAGTGTAACTCGAGTTACACTAATTAGGAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207498
RAB44 MISSION shRNA Lentiviral Transduction Particles
RAB44, member RAS oncogene family
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1571s1c1
Sequence:CCGGGAATCATTCACACACTTCTATCTCGAGATAGAAGTGTGTGAATGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1262s1c1
Sequence:CCGGCCCTCGCTATTTCTATTTGCACTCGAGTGCAAATAGAAATAGCGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1621s1c1
Sequence:CCGGCCATAATATTCACCTCCTGAACTCGAGTTCAGGAGGTGAATATTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1182s1c1
Sequence:CCGGGTAACCTGTTAATCACATGTTCTCGAGAACATGTGATTAACAGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1267s1c1
Sequence:CCGGGCTATTTCTATTTGCAAGCATCTCGAGATGCTTGCAAATAGAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-933s1c1
Sequence:CCGGCCAAACAAAGAAAGTCTAGAACTCGAGTTCTAGACTTTCTTTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207498.1-1165s1c1
Sequence:CCGGGCTGGCTCCTAATTAGTGTAACTCGAGTTACACTAATTAGGAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002786
RAB44 MISSION shRNA Bacterial Glycerol Stock
RAB44, member RAS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-2835s1c1
Sequence:CCGGCCTCTACCATGTCGTCTTCTTCTCGAGAAGAAGACGACATGGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002786.1-3904s1c1
Sequence:CCGGGCGAGGACAATTCTCTATTTACTCGAGTAAATAGAGAATTGTCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-3313s1c1
Sequence:CCGGCGGTCACTTAAGATGCAAGAACTCGAGTTCTTGCATCTTAAGTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-2113s1c1
Sequence:CCGGCCAGCCAAACAGTCCTTAGAACTCGAGTTCTAAGGACTGTTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-1567s1c1
Sequence:CCGGCCTGAGCTGTTTGGGAATAATCTCGAGATTATTCCCAAACAGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002786
RAB44 MISSION shRNA shRNA Plasmid DNA
RAB44, member RAS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-2835s1c1
Sequence:CCGGCCTCTACCATGTCGTCTTCTTCTCGAGAAGAAGACGACATGGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002786.1-3904s1c1
Sequence:CCGGGCGAGGACAATTCTCTATTTACTCGAGTAAATAGAGAATTGTCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-3313s1c1
Sequence:CCGGCGGTCACTTAAGATGCAAGAACTCGAGTTCTTGCATCTTAAGTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-2113s1c1
Sequence:CCGGCCAGCCAAACAGTCCTTAGAACTCGAGTTCTAAGGACTGTTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-1567s1c1
Sequence:CCGGCCTGAGCTGTTTGGGAATAATCTCGAGATTATTCCCAAACAGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002786
RAB44 MISSION shRNA Lentiviral Transduction Particles
RAB44, member RAS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-2835s1c1
Sequence:CCGGCCTCTACCATGTCGTCTTCTTCTCGAGAAGAAGACGACATGGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002786.1-3904s1c1
Sequence:CCGGGCGAGGACAATTCTCTATTTACTCGAGTAAATAGAGAATTGTCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-3313s1c1
Sequence:CCGGCGGTCACTTAAGATGCAAGAACTCGAGTTCTTGCATCTTAAGTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-2113s1c1
Sequence:CCGGCCAGCCAAACAGTCCTTAGAACTCGAGTTCTAAGGACTGTTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002786.1-1567s1c1
Sequence:CCGGCCTGAGCTGTTTGGGAATAATCTCGAGATTATTCCCAAACAGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)