EMAIL THIS PAGE TO A FRIEND

RAB4A

RAB4A, member RAS oncogene family

74 Gene Product Result for
Synonyms: HRES-1/RAB4 RAB4
UniProtKB ID: P20338, Q5T7P7, Q9BQ44
Gene ID:
Human(5867) Summary: This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Mouse(19341) RAB4A, member RAS oncogene family
Rat(25532) RAB4A, member RAS oncogene family
domestic guinea pig(100732679) RAB4A, member RAS oncogene family
naked mole-rat(101722103) RAB4A, member RAS oncogene family
cow(615849) RAB4A, member RAS oncogene family
sheep(100302066) RAB4A, member RAS oncogene family
Goat(100861076) RAB4A, member RAS oncogene family
Zebrafish(403031) RAB4a, member RAS oncogene family
chicken(421532) RAB4A, member RAS oncogene family
dog(479210) RAB4A, member RAS oncogene family
domestic cat(101092792) RAB4A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009003 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009003 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009003 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060341 MISSION® esiRNA esiRNA targeting mouse Rab4a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004578 Rosetta Predictions human pricing
NM_013019 Rosetta Predictions rat pricing
NM_009003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337920 predicted 570
2 SASI_Hs01_00223483 predicted 551
3 SASI_Hs01_00223484 predicted 536
4 SASI_Hs01_00223492 predicted 542
5 SASI_Hs01_00223486 predicted 593
6 SASI_Hs01_00223488 predicted 592
7 SASI_Hs01_00223485 predicted 601
8 SASI_Hs02_00337921 predicted 276
9 SASI_Hs01_00223489 predicted 347
10 SASI_Hs01_00223490 predicted 562
11 SASI_Hs01_00223487 predicted 615
12 SASI_Hs01_00223491 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100886 predicted 228
2 SASI_Rn01_00100887 predicted 244
3 SASI_Rn01_00100888 predicted 932
4 SASI_Rn01_00100889 predicted 473
5 SASI_Rn01_00100890 predicted 633
6 SASI_Rn02_00260694 predicted 266
7 SASI_Rn01_00100891 predicted 612
8 SASI_Rn01_00100892 predicted 291
9 SASI_Rn01_00100893 predicted 949
10 SASI_Rn01_00100894 predicted 1066
11 SASI_Rn01_00100895 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131970 predicted 497
2 SASI_Mm01_00131971 predicted 240
3 SASI_Mm02_00315125 predicted 279
4 SASI_Mm02_00315126 predicted 259
5 SASI_Mm01_00131972 predicted 952
6 SASI_Mm01_00131973 predicted 632
7 SASI_Mm02_00315127 predicted 973
8 SASI_Mm02_00315128 predicted 268
9 SASI_Mm01_00131977 predicted 430
10 SASI_Mm01_00131978 predicted 471
11 SASI_Mm01_00131969 predicted 1118
12 SASI_Mm01_00131974 predicted 244
13 SASI_Mm01_00131975 predicted 246
14 SASI_Mm01_00131976 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004578
VALIDATED
RAB4A MISSION shRNA Bacterial Glycerol Stock
RAB4A, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-506s21c1
Sequence:CCGGACCTACAATGCGCTTACTAATCTCGAGATTAGTAAGCGCATTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-290s21c1
Sequence:CCGGTGCTTACTTCATCAGTTTATTCTCGAGAATAAACTGATGAAGTAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004578.2-326s21c1
Sequence:CCGGGATGACTCAAATCATACAATACTCGAGTATTGTATGATTTGAGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-436s21c1
Sequence:CCGGGTCCGTGACGAGAAGTTATTACTCGAGTAATAACTTCTCGTCACGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-1169s1c1
Sequence:CCGGGCATGGAATCTGATGTATGATCTCGAGATCATACATCAGATTCCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004578.2-608s1c1
Sequence:CCGGCGTGAAGTTACCTTCTTAGAACTCGAGTTCTAAGAAGGTAACTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-500s1c1
Sequence:CCGGCGAGAAACCTACAATGCGCTTCTCGAGAAGCGCATTGTAGGTTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004578.2-776s1c1
Sequence:CCGGTCAGGTATTCAGTACGGAGATCTCGAGATCTCCGTACTGAATACCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-1191s21c1
Sequence:CCGGTGATAGAATGTGGCACTAAATCTCGAGATTTAGTGCCACATTCTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-346s1c1
Sequence:CCGGAGGAGTGGAATTTGGTTCAAACTCGAGTTTGAACCAAATTCCACTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004578
VALIDATED
RAB4A MISSION shRNA shRNA Plasmid DNA
RAB4A, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-506s21c1
Sequence:CCGGACCTACAATGCGCTTACTAATCTCGAGATTAGTAAGCGCATTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-290s21c1
Sequence:CCGGTGCTTACTTCATCAGTTTATTCTCGAGAATAAACTGATGAAGTAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004578.2-326s21c1
Sequence:CCGGGATGACTCAAATCATACAATACTCGAGTATTGTATGATTTGAGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-436s21c1
Sequence:CCGGGTCCGTGACGAGAAGTTATTACTCGAGTAATAACTTCTCGTCACGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-1169s1c1
Sequence:CCGGGCATGGAATCTGATGTATGATCTCGAGATCATACATCAGATTCCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004578.2-608s1c1
Sequence:CCGGCGTGAAGTTACCTTCTTAGAACTCGAGTTCTAAGAAGGTAACTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-500s1c1
Sequence:CCGGCGAGAAACCTACAATGCGCTTCTCGAGAAGCGCATTGTAGGTTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004578.2-776s1c1
Sequence:CCGGTCAGGTATTCAGTACGGAGATCTCGAGATCTCCGTACTGAATACCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-1191s21c1
Sequence:CCGGTGATAGAATGTGGCACTAAATCTCGAGATTTAGTGCCACATTCTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-346s1c1
Sequence:CCGGAGGAGTGGAATTTGGTTCAAACTCGAGTTTGAACCAAATTCCACTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004578
VALIDATED
RAB4A MISSION shRNA Lentiviral Transduction Particles
RAB4A, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-506s21c1
Sequence:CCGGACCTACAATGCGCTTACTAATCTCGAGATTAGTAAGCGCATTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-290s21c1
Sequence:CCGGTGCTTACTTCATCAGTTTATTCTCGAGAATAAACTGATGAAGTAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004578.2-326s21c1
Sequence:CCGGGATGACTCAAATCATACAATACTCGAGTATTGTATGATTTGAGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-436s21c1
Sequence:CCGGGTCCGTGACGAGAAGTTATTACTCGAGTAATAACTTCTCGTCACGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-1169s1c1
Sequence:CCGGGCATGGAATCTGATGTATGATCTCGAGATCATACATCAGATTCCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004578.2-608s1c1
Sequence:CCGGCGTGAAGTTACCTTCTTAGAACTCGAGTTCTAAGAAGGTAACTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-500s1c1
Sequence:CCGGCGAGAAACCTACAATGCGCTTCTCGAGAAGCGCATTGTAGGTTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004578.2-776s1c1
Sequence:CCGGTCAGGTATTCAGTACGGAGATCTCGAGATCTCCGTACTGAATACCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004578.2-1191s21c1
Sequence:CCGGTGATAGAATGTGGCACTAAATCTCGAGATTTAGTGCCACATTCTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_004578.2-346s1c1
Sequence:CCGGAGGAGTGGAATTTGGTTCAAACTCGAGTTTGAACCAAATTCCACTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009003
RAB4A MISSION shRNA Bacterial Glycerol Stock
RAB4A, member RAS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-237s1c1
Sequence:CCGGCTCAAATCATACCATAGGAATCTCGAGATTCCTATGGTATGATTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-231s1c1
Sequence:CCGGAGATGACTCAAATCATACCATCTCGAGATGGTATGATTTGAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009003.1-1143s1c1
Sequence:CCGGGCTTTCTCATTGCGTTGGTTACTCGAGTAACCAACGCAATGAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-273s1c1
Sequence:CCGGGATAATAAATGTCGGTGGTAACTCGAGTTACCACCGACATTTATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-413s1c1
Sequence:CCGGCCTACAATGCGCTTACTAATTCTCGAGAATTAGTAAGCGCATTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009003
RAB4A MISSION shRNA shRNA Plasmid DNA
RAB4A, member RAS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-237s1c1
Sequence:CCGGCTCAAATCATACCATAGGAATCTCGAGATTCCTATGGTATGATTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-231s1c1
Sequence:CCGGAGATGACTCAAATCATACCATCTCGAGATGGTATGATTTGAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009003.1-1143s1c1
Sequence:CCGGGCTTTCTCATTGCGTTGGTTACTCGAGTAACCAACGCAATGAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-273s1c1
Sequence:CCGGGATAATAAATGTCGGTGGTAACTCGAGTTACCACCGACATTTATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-413s1c1
Sequence:CCGGCCTACAATGCGCTTACTAATTCTCGAGAATTAGTAAGCGCATTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009003
RAB4A MISSION shRNA Lentiviral Transduction Particles
RAB4A, member RAS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-237s1c1
Sequence:CCGGCTCAAATCATACCATAGGAATCTCGAGATTCCTATGGTATGATTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-231s1c1
Sequence:CCGGAGATGACTCAAATCATACCATCTCGAGATGGTATGATTTGAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009003.1-1143s1c1
Sequence:CCGGGCTTTCTCATTGCGTTGGTTACTCGAGTAACCAACGCAATGAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-273s1c1
Sequence:CCGGGATAATAAATGTCGGTGGTAACTCGAGTTACCACCGACATTTATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009003.1-413s1c1
Sequence:CCGGCCTACAATGCGCTTACTAATTCTCGAGAATTAGTAAGCGCATTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)