EMAIL THIS PAGE TO A FRIEND

RAB4B

RAB4B, member RAS oncogene family

109 Gene Product Result for
UniProtKB ID: P61018, P22750, Q7Z514, Q9HBR6
Gene ID:
Human(53916) Summary: RAB proteins, such as RAB4B, are members of the RAS superfamily of small GTPases that are involved in vesicular trafficking (He et al., 2002 [PubMed 12450215]
Mouse(19342) RAB4B, member RAS oncogene family
Rat(50866) RAB4B, member RAS oncogene family
Zebrafish(445498) RAB4B, member RAS oncogene family
domestic cat(101090309) RAB4B, member RAS oncogene family
dog(403956) RAB4B, member RAS oncogene family
cow(616314) RAB4B, member RAS oncogene family
sheep(101121286) RAB4B, member RAS oncogene family
domestic guinea pig(100726605) RAB4B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305859 ANTI-RAB4B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0266 AQUA Peptide GAAGALLVYDIT[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat, soybean, wheat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016154 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006611 MISSION® esiRNA esiRNA targeting mouse Rab4b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016154 Rosetta Predictions human pricing
NM_017355 Rosetta Predictions rat pricing
NM_029391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072160 predicted 321
2 SASI_Hs01_00072161 predicted 261
3 SASI_Hs01_00072162 predicted 604
4 SASI_Hs02_00348958 predicted 320
5 SASI_Hs01_00072164 predicted 647
6 SASI_Hs02_00348959 predicted 450
7 SASI_Hs01_00072165 predicted 250
8 SASI_Hs01_00072166 predicted 321
9 SASI_Hs01_00072167 predicted 840
10 SASI_Hs01_00072168 predicted 368
11 SASI_Hs01_00072163 predicted 818
12 SASI_Hs01_00072169 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065884 predicted 567
2 SASI_Rn01_00065885 predicted 610
3 SASI_Rn01_00065886 predicted 465
4 SASI_Rn01_00065888 predicted 588
5 SASI_Rn01_00065889 predicted 230
6 SASI_Rn01_00065890 predicted 591
7 SASI_Rn01_00065891 predicted 443
8 SASI_Rn01_00065892 predicted 544
9 SASI_Rn01_00065893 predicted 242
10 SASI_Rn02_00261845 predicted 580
11 SASI_Rn01_00065887 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139723 predicted 695
2 SASI_Mm01_00139724 predicted 247
3 SASI_Mm01_00139725 predicted 528
4 SASI_Mm01_00139726 predicted 648
5 SASI_Mm01_00139727 predicted 543
6 SASI_Mm01_00139728 predicted 796
7 SASI_Mm01_00139729 predicted 300
8 SASI_Mm01_00139730 predicted 592
9 SASI_Mm01_00139731 predicted 781
10 SASI_Mm01_00139732 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029391
RAB4B MISSION shRNA Bacterial Glycerol Stock
RAB4B, member RAS oncogene family
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029391.2-185s21c1
Sequence:GTACCGGGCAGTGCTGGAACTGGCAAATCTCGAGATTTGCCAGTTCCAGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-216s1c1
Sequence:CCGGCCACCAGTTTATTGAGAATAACTCGAGTTATTCTCAATAAACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-425s1c1
Sequence:CCGGCATACAACTCACTCGCTGCTTCTCGAGAAGCAGCGAGTGAGTTGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-698s1c1
Sequence:CCGGGCATTCAGTATGGCGACATATCTCGAGATATGTCGCCATACTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-305s1c1
Sequence:CCGGAGACTGTGAAACTACAGATTTCTCGAGAAATCTGTAGTTTCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-215s1c1
Sequence:CCGGTCCACCAGTTTATTGAGAATACTCGAGTATTCTCAATAAACTGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029391.2-699s21c1
Sequence:GTACCGGCATTCAGTATGGCGACATATCCTCGAGGATATGTCGCCATACTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029391
RAB4B MISSION shRNA shRNA Plasmid DNA
RAB4B, member RAS oncogene family
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029391.2-185s21c1
Sequence:GTACCGGGCAGTGCTGGAACTGGCAAATCTCGAGATTTGCCAGTTCCAGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-216s1c1
Sequence:CCGGCCACCAGTTTATTGAGAATAACTCGAGTTATTCTCAATAAACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-425s1c1
Sequence:CCGGCATACAACTCACTCGCTGCTTCTCGAGAAGCAGCGAGTGAGTTGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-698s1c1
Sequence:CCGGGCATTCAGTATGGCGACATATCTCGAGATATGTCGCCATACTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-305s1c1
Sequence:CCGGAGACTGTGAAACTACAGATTTCTCGAGAAATCTGTAGTTTCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-215s1c1
Sequence:CCGGTCCACCAGTTTATTGAGAATACTCGAGTATTCTCAATAAACTGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029391.2-699s21c1
Sequence:GTACCGGCATTCAGTATGGCGACATATCCTCGAGGATATGTCGCCATACTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029391
RAB4B MISSION shRNA Lentiviral Transduction Particles
RAB4B, member RAS oncogene family
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029391.2-185s21c1
Sequence:GTACCGGGCAGTGCTGGAACTGGCAAATCTCGAGATTTGCCAGTTCCAGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-216s1c1
Sequence:CCGGCCACCAGTTTATTGAGAATAACTCGAGTTATTCTCAATAAACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-425s1c1
Sequence:CCGGCATACAACTCACTCGCTGCTTCTCGAGAAGCAGCGAGTGAGTTGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-698s1c1
Sequence:CCGGGCATTCAGTATGGCGACATATCTCGAGATATGTCGCCATACTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-305s1c1
Sequence:CCGGAGACTGTGAAACTACAGATTTCTCGAGAAATCTGTAGTTTCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029391.1-215s1c1
Sequence:CCGGTCCACCAGTTTATTGAGAATACTCGAGTATTCTCAATAAACTGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029391.2-699s21c1
Sequence:GTACCGGCATTCAGTATGGCGACATATCCTCGAGGATATGTCGCCATACTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016154
VALIDATED
RAB4B MISSION shRNA Bacterial Glycerol Stock
RAB4B, member RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016154.2-1840s1c1
Sequence:CCGGCCTAACCATATCCCAAGAGCTCTCGAGAGCTCTTGGGATATGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016154.2-892s1c1
Sequence:CCGGAGAGAGAGATTGGATTGGAATCTCGAGATTCCAATCCAATCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016154.2-1460s1c1
Sequence:CCGGCGCACTATCCTCAACAAGATTCTCGAGAATCTTGTTGAGGATAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016154.2-1016s1c1
Sequence:CCGGACTGGCAAATCATGTCTCCTTCTCGAGAAGGAGACATGATTTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-275s21c1
Sequence:GTACCGGGACTGTGAAGCTACAGATTTGCTCGAGCAAATCTGTAGCTTCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-193s21c1
Sequence:GTACCGGTCATTGAGAATAAGTTCAAACCTCGAGGTTTGAACTTATTCTCAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-322s21c1
Sequence:GTACCGGGGTCAGTGACGCGGAGTTATTCTCGAGAATAACTCCGCGTCACTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-154s21c1
Sequence:GTACCGGGCAGTGCAGGAACTGGCAAATCTCGAGATTTGCCAGTTCCTGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-455s21c1
Sequence:GTACCGGGGTCATCCTCTGTGGCAACAACTCGAGTTGTTGCCACAGAGGATGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-610s21c1
Sequence:GTACCGGGCACTATCCTCAACAAGATTGCTCGAGCAATCTTGTTGAGGATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-656s21c1
Sequence:GTACCGGGATGGGCTCTGGCATTCAGTACTCGAGTACTGAATGCCAGAGCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016154
VALIDATED
RAB4B MISSION shRNA shRNA Plasmid DNA
RAB4B, member RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016154.2-1840s1c1
Sequence:CCGGCCTAACCATATCCCAAGAGCTCTCGAGAGCTCTTGGGATATGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016154.2-892s1c1
Sequence:CCGGAGAGAGAGATTGGATTGGAATCTCGAGATTCCAATCCAATCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016154.2-1460s1c1
Sequence:CCGGCGCACTATCCTCAACAAGATTCTCGAGAATCTTGTTGAGGATAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016154.2-1016s1c1
Sequence:CCGGACTGGCAAATCATGTCTCCTTCTCGAGAAGGAGACATGATTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-275s21c1
Sequence:GTACCGGGACTGTGAAGCTACAGATTTGCTCGAGCAAATCTGTAGCTTCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-193s21c1
Sequence:GTACCGGTCATTGAGAATAAGTTCAAACCTCGAGGTTTGAACTTATTCTCAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-322s21c1
Sequence:GTACCGGGGTCAGTGACGCGGAGTTATTCTCGAGAATAACTCCGCGTCACTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-154s21c1
Sequence:GTACCGGGCAGTGCAGGAACTGGCAAATCTCGAGATTTGCCAGTTCCTGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-455s21c1
Sequence:GTACCGGGGTCATCCTCTGTGGCAACAACTCGAGTTGTTGCCACAGAGGATGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-610s21c1
Sequence:GTACCGGGCACTATCCTCAACAAGATTGCTCGAGCAATCTTGTTGAGGATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-656s21c1
Sequence:GTACCGGGATGGGCTCTGGCATTCAGTACTCGAGTACTGAATGCCAGAGCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016154
VALIDATED
RAB4B MISSION shRNA Lentiviral Transduction Particles
RAB4B, member RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016154.2-1840s1c1
Sequence:CCGGCCTAACCATATCCCAAGAGCTCTCGAGAGCTCTTGGGATATGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016154.2-892s1c1
Sequence:CCGGAGAGAGAGATTGGATTGGAATCTCGAGATTCCAATCCAATCTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_016154.2-1460s1c1
Sequence:CCGGCGCACTATCCTCAACAAGATTCTCGAGAATCTTGTTGAGGATAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016154.2-1016s1c1
Sequence:CCGGACTGGCAAATCATGTCTCCTTCTCGAGAAGGAGACATGATTTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-275s21c1
Sequence:GTACCGGGACTGTGAAGCTACAGATTTGCTCGAGCAAATCTGTAGCTTCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-193s21c1
Sequence:GTACCGGTCATTGAGAATAAGTTCAAACCTCGAGGTTTGAACTTATTCTCAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-322s21c1
Sequence:GTACCGGGGTCAGTGACGCGGAGTTATTCTCGAGAATAACTCCGCGTCACTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-154s21c1
Sequence:GTACCGGGCAGTGCAGGAACTGGCAAATCTCGAGATTTGCCAGTTCCTGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-455s21c1
Sequence:GTACCGGGGTCATCCTCTGTGGCAACAACTCGAGTTGTTGCCACAGAGGATGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-610s21c1
Sequence:GTACCGGGCACTATCCTCAACAAGATTGCTCGAGCAATCTTGTTGAGGATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016154.3-656s21c1
Sequence:GTACCGGGATGGGCTCTGGCATTCAGTACTCGAGTACTGAATGCCAGAGCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)