EMAIL THIS PAGE TO A FRIEND

RAB5A

RAB5A, member RAS oncogene family

131 Gene Product Result for
Synonyms: RAB5
UniProtKB ID: P20339, Q6FI44
Gene ID:
Mouse(271457) RAB5A, member RAS oncogene family
Rat(64633) RAB5A, member RAS oncogene family
chicken(420649) RAB5A, member RAS oncogene family
dog(404008) RAB5A, member RAS oncogene family
domestic cat(101099995) RAB5A, member RAS oncogene family
domestic guinea pig(100723790) RAB5A, member RAS oncogene family
naked mole-rat(101710661) RAB5A, member RAS oncogene family
cow(539764) RAB5A, member RAS oncogene family
sheep(100302084) RAB5A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R4654 Anti-Rab5 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, western blot pricing
R7904 Anti-Rab5 antibody, Mouse monoclonal clone Rab5-65, purified from hybridoma cell culture mouse, cat, rat, bovine, human
ELISA, immunocytochemistry, microarray, western blot pricing
SAB1306597 ANTI-RAB5(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2104787 Anti-RAB5A antibody produced in rabbit affinity isolated antibody human, bovine, pig, rat, sheep, horse, mouse, rabbit, dog
western blot pricing
SAB2104788 Anti-RAB5A antibody produced in rabbit affinity isolated antibody human, dog, guinea pig, rat, mouse, horse
immunohistochemistry, western blot pricing
SAB2107608 Anti-RAB5A antibody produced in rabbit affinity isolated antibody human, sheep, bovine
western blot pricing
SAB2107609 Anti-RAB5A antibody produced in rabbit affinity isolated antibody bovine, horse, guinea pig, rat, mouse, sheep, rabbit, dog, human
western blot pricing
HPA049354 Anti-RAB5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0005868M9 Monoclonal Anti-RAB5A antibody produced in mouse clone 5D1, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004162 Rosetta Predictions human pricing
NM_022692 Rosetta Predictions rat pricing
NM_025887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097508 predicted 816
2 SASI_Hs01_00097512 predicted 994
3 SASI_Hs01_00097514 predicted 1071
4 SASI_Hs01_00097515 predicted 1081
5 SASI_Hs01_00097516 predicted 1034
6 SASI_Hs01_00097517 predicted 1008
7 SASI_Hs02_00337023 predicted 822
8 SASI_Hs02_00337024 predicted 741
9 SASI_Hs02_00337025 predicted 747
10 SASI_Hs02_00337026 predicted 1000
11 SASI_Hs01_00097509 predicted 562
12 SASI_Hs01_00097510 predicted 730
13 SASI_Hs01_00097511 predicted 664
14 SASI_Hs01_00097513 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064572 predicted 285
2 SASI_Rn01_00064573 predicted 275
3 SASI_Rn01_00064574 predicted 231
4 SASI_Rn01_00064575 predicted 357
5 SASI_Rn02_00263484 predicted 253
6 SASI_Rn01_00064576 predicted 239
7 SASI_Rn01_00064577 predicted 377
8 SASI_Rn01_00064578 predicted 348
9 SASI_Rn01_00064579 predicted 279
10 SASI_Rn01_00064580 predicted 356
11 SASI_Rn01_00064581 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169520 predicted 593
2 SASI_Mm01_00169521 predicted 647
3 SASI_Mm01_00169522 predicted 1197
4 SASI_Mm01_00169523 predicted 1194
5 SASI_Mm01_00169524 predicted 841
6 SASI_Mm01_00169525 predicted 810
7 SASI_Mm01_00169526 predicted 704
8 SASI_Mm01_00169527 predicted 469
9 SASI_Mm01_00169528 predicted 1207
10 SASI_Mm01_00169529 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004162
VALIDATED
RAB5A MISSION shRNA Bacterial Glycerol Stock
RAB5A, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-781s21c1
Sequence:GTACCGGCCATAGCCTAGCACCAATGTACTCGAGTACATTGGTGCTAGGCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-564s21c1
Sequence:CCGGACGGGCCAAATACGGGAAATACTCGAGTATTTCCCGTATTTGGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-1158s21c1
Sequence:CCGGCCAGGAATCAGTGTTGTAGTACTCGAGTACTACAACACTGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-894s21c1
Sequence:CCGGGGCAAGCAAGTCCTAACATTGCTCGAGCAATGTTAGGACTTGCTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-934s21c1
Sequence:GTACCGGCAAGGCCGACCTAGCAAATAACTCGAGTTATTTGCTAGGTCGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-674s21c1
Sequence:GTACCGGGAATTTCAAGAGAGTACCATTCTCGAGAATGGTACTCTCTTGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-659s1c1
Sequence:CCGGGCAGCCATAGTTGTATATGATCTCGAGATCATATACAACTATGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004162.3-406s1c1
Sequence:CCGGCGGGCCAAATACTGGAAATAACTCGAGTTATTTCCAGTATTTGGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-606s1c1
Sequence:CCGGCTGGTCAAGAACGATACCATACTCGAGTATGGTATCGTTCTTGACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-2298s21c1
Sequence:CCGGGCAGCCTTCCTTTCCAAAGTTCTCGAGAACTTTGGAAAGGAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-999s1c1
Sequence:CCGGCCAGGAATCAGTGTTGTAGTACTCGAGTACTACAACACTGATTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-989s21c1
Sequence:CCGGGCAGATGACAATAGTTTATTACTCGAGTAATAAACTATTGTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-615s21c1
Sequence:GTACCGGGAGAGTCCGCTGTTGGCAAATCTCGAGATTTGCCAACAGCGGACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-2139s1c1
Sequence:CCGGGCAGCCTTCCTTTCCAAAGTTCTCGAGAACTTTGGAAAGGAAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004162
VALIDATED
RAB5A MISSION shRNA shRNA Plasmid DNA
RAB5A, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-781s21c1
Sequence:GTACCGGCCATAGCCTAGCACCAATGTACTCGAGTACATTGGTGCTAGGCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-564s21c1
Sequence:CCGGACGGGCCAAATACGGGAAATACTCGAGTATTTCCCGTATTTGGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-1158s21c1
Sequence:CCGGCCAGGAATCAGTGTTGTAGTACTCGAGTACTACAACACTGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-894s21c1
Sequence:CCGGGGCAAGCAAGTCCTAACATTGCTCGAGCAATGTTAGGACTTGCTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-934s21c1
Sequence:GTACCGGCAAGGCCGACCTAGCAAATAACTCGAGTTATTTGCTAGGTCGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-674s21c1
Sequence:GTACCGGGAATTTCAAGAGAGTACCATTCTCGAGAATGGTACTCTCTTGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-659s1c1
Sequence:CCGGGCAGCCATAGTTGTATATGATCTCGAGATCATATACAACTATGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004162.3-406s1c1
Sequence:CCGGCGGGCCAAATACTGGAAATAACTCGAGTTATTTCCAGTATTTGGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-606s1c1
Sequence:CCGGCTGGTCAAGAACGATACCATACTCGAGTATGGTATCGTTCTTGACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-2298s21c1
Sequence:CCGGGCAGCCTTCCTTTCCAAAGTTCTCGAGAACTTTGGAAAGGAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-999s1c1
Sequence:CCGGCCAGGAATCAGTGTTGTAGTACTCGAGTACTACAACACTGATTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-989s21c1
Sequence:CCGGGCAGATGACAATAGTTTATTACTCGAGTAATAAACTATTGTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-615s21c1
Sequence:GTACCGGGAGAGTCCGCTGTTGGCAAATCTCGAGATTTGCCAACAGCGGACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-2139s1c1
Sequence:CCGGGCAGCCTTCCTTTCCAAAGTTCTCGAGAACTTTGGAAAGGAAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004162
VALIDATED
RAB5A MISSION shRNA Lentiviral Transduction Particles
RAB5A, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-781s21c1
Sequence:GTACCGGCCATAGCCTAGCACCAATGTACTCGAGTACATTGGTGCTAGGCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-564s21c1
Sequence:CCGGACGGGCCAAATACGGGAAATACTCGAGTATTTCCCGTATTTGGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-1158s21c1
Sequence:CCGGCCAGGAATCAGTGTTGTAGTACTCGAGTACTACAACACTGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-894s21c1
Sequence:CCGGGGCAAGCAAGTCCTAACATTGCTCGAGCAATGTTAGGACTTGCTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-934s21c1
Sequence:GTACCGGCAAGGCCGACCTAGCAAATAACTCGAGTTATTTGCTAGGTCGGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-674s21c1
Sequence:GTACCGGGAATTTCAAGAGAGTACCATTCTCGAGAATGGTACTCTCTTGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-659s1c1
Sequence:CCGGGCAGCCATAGTTGTATATGATCTCGAGATCATATACAACTATGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004162.3-406s1c1
Sequence:CCGGCGGGCCAAATACTGGAAATAACTCGAGTTATTTCCAGTATTTGGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-606s1c1
Sequence:CCGGCTGGTCAAGAACGATACCATACTCGAGTATGGTATCGTTCTTGACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-2298s21c1
Sequence:CCGGGCAGCCTTCCTTTCCAAAGTTCTCGAGAACTTTGGAAAGGAAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-999s1c1
Sequence:CCGGCCAGGAATCAGTGTTGTAGTACTCGAGTACTACAACACTGATTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004162.4-989s21c1
Sequence:CCGGGCAGATGACAATAGTTTATTACTCGAGTAATAAACTATTGTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004162.4-615s21c1
Sequence:GTACCGGGAGAGTCCGCTGTTGGCAAATCTCGAGATTTGCCAACAGCGGACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004162.3-2139s1c1
Sequence:CCGGGCAGCCTTCCTTTCCAAAGTTCTCGAGAACTTTGGAAAGGAAGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025887
RAB5A MISSION shRNA Bacterial Glycerol Stock
RAB5A, member RAS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-748s1c1
Sequence:CCGGCAAGCAGCCATAGTTGTGTATCTCGAGATACACAACTATGGCTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025887.2-1480s1c1
Sequence:CCGGCCCAAGCAAATGGTGTAATTTCTCGAGAAATTACACCATTTGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-697s1c1
Sequence:CCGGGCTGGTCAAGAACGGTATCATCTCGAGATGATACCGTTCTTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-751s1c1
Sequence:CCGGGCAGCCATAGTTGTGTATGATCTCGAGATCATACACAACTATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-583s1c1
Sequence:CCGGCGCTTTGTGAAAGGCCAATTTCTCGAGAAATTGGCCTTTCACAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025887
RAB5A MISSION shRNA shRNA Plasmid DNA
RAB5A, member RAS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-748s1c1
Sequence:CCGGCAAGCAGCCATAGTTGTGTATCTCGAGATACACAACTATGGCTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025887.2-1480s1c1
Sequence:CCGGCCCAAGCAAATGGTGTAATTTCTCGAGAAATTACACCATTTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-697s1c1
Sequence:CCGGGCTGGTCAAGAACGGTATCATCTCGAGATGATACCGTTCTTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-751s1c1
Sequence:CCGGGCAGCCATAGTTGTGTATGATCTCGAGATCATACACAACTATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-583s1c1
Sequence:CCGGCGCTTTGTGAAAGGCCAATTTCTCGAGAAATTGGCCTTTCACAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025887
RAB5A MISSION shRNA Lentiviral Transduction Particles
RAB5A, member RAS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-748s1c1
Sequence:CCGGCAAGCAGCCATAGTTGTGTATCTCGAGATACACAACTATGGCTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025887.2-1480s1c1
Sequence:CCGGCCCAAGCAAATGGTGTAATTTCTCGAGAAATTACACCATTTGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-697s1c1
Sequence:CCGGGCTGGTCAAGAACGGTATCATCTCGAGATGATACCGTTCTTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-751s1c1
Sequence:CCGGGCAGCCATAGTTGTGTATGATCTCGAGATCATACACAACTATGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025887.2-583s1c1
Sequence:CCGGCGCTTTGTGAAAGGCCAATTTCTCGAGAAATTGGCCTTTCACAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)