EMAIL THIS PAGE TO A FRIEND

RAB5C

RAB5C, member RAS oncogene family

88 Gene Product Result for
Synonyms: L1880 RAB5CL RAB5L RABL
UniProtKB ID: P51148, F8W1H5, Q6FH55, Q9P0Y5
Gene ID:
Human(5878) Summary: Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment (Han et al., 1996 [PubMed 8646882]
Mouse(19345) RAB5C, member RAS oncogene family
Rat(287709) RAB5C, member RAS oncogene family
Zebrafish(386807) RAB5C, member RAS oncogene family
domestic cat(101094966) RAB5C, member RAS oncogene family
dog(403941) RAB5C, member RAS oncogene family
chicken(395197) RAB5C, member RAS oncogene family
cow(613749) RAB5C, member RAS oncogene family
sheep(101122039) RAB5C, member RAS oncogene family
naked mole-rat(101696324) RAB5C, member RAS oncogene family
domestic guinea pig(100716247) RAB5C, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004583 Rosetta Predictions human pricing
NM_201434 Rosetta Predictions human pricing
NM_001105840 Rosetta Predictions rat pricing
NM_024456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337929 predicted 695
2 SASI_Hs01_00138524 predicted 479
3 SASI_Hs02_00337930 predicted 695
4 SASI_Hs01_00138526 predicted 609
5 SASI_Hs01_00138527 predicted 1185
6 SASI_Hs01_00138528 predicted 641
7 SASI_Hs01_00138530 predicted 708
8 SASI_Hs01_00138532 predicted 643
9 SASI_Hs01_00138533 predicted 481
10 SASI_Hs02_00337931 predicted 652
11 SASI_Hs01_00138525 predicted 317
12 SASI_Hs01_00138529 predicted 697
13 SASI_Hs01_00138531 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372970 predicted 816
2 SASI_Hs01_00156130 predicted 599
3 SASI_Hs02_00372971 predicted 816
4 SASI_Hs01_00156132 predicted 733
5 SASI_Hs01_00156133 predicted 1309
6 SASI_Hs01_00156134 predicted 762
7 SASI_Hs01_00156136 predicted 828
8 SASI_Hs01_00156138 predicted 766
9 SASI_Hs01_00156139 predicted 601
10 SASI_Hs02_00372972 predicted 774
11 SASI_Hs01_00156131 predicted 435
12 SASI_Hs01_00156135 predicted 808
13 SASI_Hs01_00156137 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213042 predicted 516
2 SASI_Rn02_00213043 predicted 1019
3 SASI_Rn02_00213044 predicted 486
4 SASI_Rn02_00213045 predicted 898
5 SASI_Rn02_00213046 predicted 1025
6 SASI_Rn02_00213047 predicted 976
7 SASI_Rn02_00213048 predicted 658
8 SASI_Rn02_00213049 predicted 686
9 SASI_Rn02_00213050 predicted 613
10 SASI_Rn02_00213051 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105011 predicted 453
2 SASI_Mm01_00105013 predicted 427
3 SASI_Mm01_00105014 predicted 838
4 SASI_Mm02_00327807 predicted 964
5 SASI_Mm01_00105015 predicted 334
6 SASI_Mm01_00105016 predicted 668
7 SASI_Mm01_00105017 predicted 456
8 SASI_Mm01_00105018 predicted 855
9 SASI_Mm01_00105019 predicted 592
10 SASI_Mm01_00105020 predicted 843
11 SASI_Mm01_00105012 predicted 1090
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004583
VALIDATED
RAB5C MISSION shRNA Bacterial Glycerol Stock
RAB5C, member RAS oncogene family
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-319s21c1
Sequence:GTACCGGGCTTTGTCAAGGGACAGTTTCCTCGAGGAAACTGTCCCTTGACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-506s21c1
Sequence:CCGGCATCACCAACACAGATACATTCTCGAGAATGTATCTGTGTTGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-713s21c1
Sequence:CCGGGAACGAAATCTTCATGGCAATCTCGAGATTGCCATGAAGATTTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-583s21c1
Sequence:CCGGTCATTGCACTCGCGGGTAACACTCGAGTGTTACCCGCGAGTGCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-690s21c1
Sequence:GTACCGGTCAGCAAAGACTGCAATGAACCTCGAGGTTCATTGCAGTCTTTGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-713s1c1
Sequence:CCGGGAACGAAATCTTCATGGCAATCTCGAGATTGCCATGAAGATTTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004583.2-969s21c1
Sequence:CCGGCCACCATGATTTCTCCATATACTCGAGTATATGGAGAAATCATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004583.2-662s1c1
Sequence:CCGGCGACAACAGTTTGCTGTTCATCTCGAGATGAACAGCAAACTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-506s1c1
Sequence:CCGGCATCACCAACACAGATACATTCTCGAGAATGTATCTGTGTTGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-969s1c1
Sequence:CCGGCCACCATGATTTCTCCATATACTCGAGTATATGGAGAAATCATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-654s21c1
Sequence:GTACCGGTATGCAGACGACAACAGTTTGCTCGAGCAAACTGTTGTCGTCTGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004583.2-243s1c1
Sequence:CCGGGCTGGGAACAAGATCTGTCAACTCGAGTTGACAGATCTTGTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-247s21c1
Sequence:GTACCGGGGAACAAGATCTGTCAATTTACTCGAGTAAATTGACAGATCTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004583
VALIDATED
RAB5C MISSION shRNA shRNA Plasmid DNA
RAB5C, member RAS oncogene family
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-319s21c1
Sequence:GTACCGGGCTTTGTCAAGGGACAGTTTCCTCGAGGAAACTGTCCCTTGACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-506s21c1
Sequence:CCGGCATCACCAACACAGATACATTCTCGAGAATGTATCTGTGTTGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-713s21c1
Sequence:CCGGGAACGAAATCTTCATGGCAATCTCGAGATTGCCATGAAGATTTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-583s21c1
Sequence:CCGGTCATTGCACTCGCGGGTAACACTCGAGTGTTACCCGCGAGTGCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-690s21c1
Sequence:GTACCGGTCAGCAAAGACTGCAATGAACCTCGAGGTTCATTGCAGTCTTTGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-713s1c1
Sequence:CCGGGAACGAAATCTTCATGGCAATCTCGAGATTGCCATGAAGATTTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004583.2-969s21c1
Sequence:CCGGCCACCATGATTTCTCCATATACTCGAGTATATGGAGAAATCATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004583.2-662s1c1
Sequence:CCGGCGACAACAGTTTGCTGTTCATCTCGAGATGAACAGCAAACTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-506s1c1
Sequence:CCGGCATCACCAACACAGATACATTCTCGAGAATGTATCTGTGTTGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-969s1c1
Sequence:CCGGCCACCATGATTTCTCCATATACTCGAGTATATGGAGAAATCATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-654s21c1
Sequence:GTACCGGTATGCAGACGACAACAGTTTGCTCGAGCAAACTGTTGTCGTCTGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004583.2-243s1c1
Sequence:CCGGGCTGGGAACAAGATCTGTCAACTCGAGTTGACAGATCTTGTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-247s21c1
Sequence:GTACCGGGGAACAAGATCTGTCAATTTACTCGAGTAAATTGACAGATCTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004583
VALIDATED
RAB5C MISSION shRNA Lentiviral Transduction Particles
RAB5C, member RAS oncogene family
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-319s21c1
Sequence:GTACCGGGCTTTGTCAAGGGACAGTTTCCTCGAGGAAACTGTCCCTTGACAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-506s21c1
Sequence:CCGGCATCACCAACACAGATACATTCTCGAGAATGTATCTGTGTTGGTGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-713s21c1
Sequence:CCGGGAACGAAATCTTCATGGCAATCTCGAGATTGCCATGAAGATTTCGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000310771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-583s21c1
Sequence:CCGGTCATTGCACTCGCGGGTAACACTCGAGTGTTACCCGCGAGTGCAATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-690s21c1
Sequence:GTACCGGTCAGCAAAGACTGCAATGAACCTCGAGGTTCATTGCAGTCTTTGCTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-713s1c1
Sequence:CCGGGAACGAAATCTTCATGGCAATCTCGAGATTGCCATGAAGATTTCGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004583.2-969s21c1
Sequence:CCGGCCACCATGATTTCTCCATATACTCGAGTATATGGAGAAATCATGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004583.2-662s1c1
Sequence:CCGGCGACAACAGTTTGCTGTTCATCTCGAGATGAACAGCAAACTGTTGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-506s1c1
Sequence:CCGGCATCACCAACACAGATACATTCTCGAGAATGTATCTGTGTTGGTGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004583.2-969s1c1
Sequence:CCGGCCACCATGATTTCTCCATATACTCGAGTATATGGAGAAATCATGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004583.2-654s21c1
Sequence:GTACCGGTATGCAGACGACAACAGTTTGCTCGAGCAAACTGTTGTCGTCTGCATATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004583.2-243s1c1
Sequence:CCGGGCTGGGAACAAGATCTGTCAACTCGAGTTGACAGATCTTGTTCCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004583.2-247s21c1
Sequence:GTACCGGGGAACAAGATCTGTCAATTTACTCGAGTAAATTGACAGATCTTGTTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024456
VALIDATED
RAB5C MISSION shRNA Bacterial Glycerol Stock
RAB5C, member RAS oncogene family
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-643s21c1
Sequence:CCGGGCAATGAACGTGAATGAAATTCTCGAGAATTTCATTCACGTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-676s21c1
Sequence:CCGGGCTAAGAAGCTTCCCAAGAATCTCGAGATTCTTGGGAAGCTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-188s21c1
Sequence:CCGGGCAACAAGATCTGTCAGTTTACTCGAGTAAACTGACAGATCTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024456.4-835s21c1
Sequence:CCGGCCCGACTGGAATCTACTCTAACTCGAGTTAGAGTAGATTCCAGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-950s1c1
Sequence:CCGGCCCGACTGGAATCTACTCTAACTCGAGTTAGAGTAGATTCCAGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-791s1c1
Sequence:CCGGGCTAAGAAGCTTCCCAAGAATCTCGAGATTCTTGGGAAGCTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-758s1c1
Sequence:CCGGGCAATGAACGTGAATGAAATTCTCGAGAATTTCATTCACGTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-249s1c1
Sequence:CCGGGCAACAAGATCTGTCAGTTTACTCGAGTAAACTGACAGATCTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024456.1-575s1c1
Sequence:CCGGCCCAACATCGTCATTGCACTACTCGAGTAGTGCAATGACGATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024456
VALIDATED
RAB5C MISSION shRNA shRNA Plasmid DNA
RAB5C, member RAS oncogene family
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-643s21c1
Sequence:CCGGGCAATGAACGTGAATGAAATTCTCGAGAATTTCATTCACGTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-676s21c1
Sequence:CCGGGCTAAGAAGCTTCCCAAGAATCTCGAGATTCTTGGGAAGCTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-188s21c1
Sequence:CCGGGCAACAAGATCTGTCAGTTTACTCGAGTAAACTGACAGATCTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024456.4-835s21c1
Sequence:CCGGCCCGACTGGAATCTACTCTAACTCGAGTTAGAGTAGATTCCAGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-950s1c1
Sequence:CCGGCCCGACTGGAATCTACTCTAACTCGAGTTAGAGTAGATTCCAGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-791s1c1
Sequence:CCGGGCTAAGAAGCTTCCCAAGAATCTCGAGATTCTTGGGAAGCTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-758s1c1
Sequence:CCGGGCAATGAACGTGAATGAAATTCTCGAGAATTTCATTCACGTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-249s1c1
Sequence:CCGGGCAACAAGATCTGTCAGTTTACTCGAGTAAACTGACAGATCTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024456.1-575s1c1
Sequence:CCGGCCCAACATCGTCATTGCACTACTCGAGTAGTGCAATGACGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024456
VALIDATED
RAB5C MISSION shRNA Lentiviral Transduction Particles
RAB5C, member RAS oncogene family
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-643s21c1
Sequence:CCGGGCAATGAACGTGAATGAAATTCTCGAGAATTTCATTCACGTTCATTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-676s21c1
Sequence:CCGGGCTAAGAAGCTTCCCAAGAATCTCGAGATTCTTGGGAAGCTTCTTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024456.4-188s21c1
Sequence:CCGGGCAACAAGATCTGTCAGTTTACTCGAGTAAACTGACAGATCTTGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000332131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024456.4-835s21c1
Sequence:CCGGCCCGACTGGAATCTACTCTAACTCGAGTTAGAGTAGATTCCAGTCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-950s1c1
Sequence:CCGGCCCGACTGGAATCTACTCTAACTCGAGTTAGAGTAGATTCCAGTCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-791s1c1
Sequence:CCGGGCTAAGAAGCTTCCCAAGAATCTCGAGATTCTTGGGAAGCTTCTTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-758s1c1
Sequence:CCGGGCAATGAACGTGAATGAAATTCTCGAGAATTTCATTCACGTTCATTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024456.1-249s1c1
Sequence:CCGGGCAACAAGATCTGTCAGTTTACTCGAGTAAACTGACAGATCTTGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000100746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024456.1-575s1c1
Sequence:CCGGCCCAACATCGTCATTGCACTACTCGAGTAGTGCAATGACGATGTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???