EMAIL THIS PAGE TO A FRIEND

RAB6B

RAB6B, member RAS oncogene family

172 Gene Product Result for
UniProtKB ID: Q9NRW1, B2R5Z9, D3DND3, Q92929
Gene ID:
Mouse(270192) RAB6B, member RAS oncogene family
Rat(363123) RAB6B, member RAS oncogene family
cow(526526) RAB6B, member RAS oncogene family
sheep(101116194) RAB6B, member RAS oncogene family
domestic guinea pig(100727333) RAB6B, member RAS oncogene family
naked mole-rat(101720322) RAB6B, member RAS oncogene family
Zebrafish(558900) RAB6B, member RAS oncogene family
dog(610830) RAB6B, member RAS oncogene family
chicken(422155) RAB6B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016577 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006211 MISSION® esiRNA esiRNA targeting human RAB6B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016577 Rosetta Predictions human pricing
NM_001108775 Rosetta Predictions rat pricing
NM_173781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349704 predicted 891
2 SASI_Hs01_00028941 predicted 1031
3 SASI_Hs02_00349705 predicted 673
4 SASI_Hs01_00028943 predicted 807
5 SASI_Hs01_00028944 predicted 935
6 SASI_Hs01_00028945 predicted 682
7 SASI_Hs01_00028946 predicted 927
8 SASI_Hs01_00028947 predicted 810
9 SASI_Hs01_00028948 predicted 680
10 SASI_Hs01_00028949 predicted 841
11 SASI_Hs01_00028942 predicted 828
12 SASI_Hs01_00028950 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241955 predicted 364
2 SASI_Rn02_00241956 predicted 225
3 SASI_Rn02_00241957 predicted 487
4 SASI_Rn02_00241958 predicted 221
5 SASI_Rn02_00241959 predicted 234
6 SASI_Rn02_00241960 predicted 323
7 SASI_Rn02_00241961 predicted 473
8 SASI_Rn02_00241962 predicted 222
9 SASI_Rn02_00241963 predicted 420
10 SASI_Rn02_00241964 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177388 predicted 509
2 SASI_Mm01_00177389 predicted 351
3 SASI_Mm01_00177390 predicted 920
4 SASI_Mm01_00177391 predicted 393
5 SASI_Mm01_00177392 predicted 244
6 SASI_Mm01_00177393 predicted 1195
7 SASI_Mm01_00177394 predicted 1189
8 SASI_Mm01_00177395 predicted 634
9 SASI_Mm02_00345432 predicted 153
10 SASI_Mm02_00345433 predicted 349
11 SASI_Mm01_00177396 predicted 1199
12 SASI_Mm01_00177397 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173781
RAB6B MISSION shRNA Bacterial Glycerol Stock
RAB6B, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-791s21c1
Sequence:GTACCGGATCAAGACTGGAGGATCTTTCCTCGAGGAAAGATCCTCCAGTCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173781.4-461s21c1
Sequence:GTACCGGCAAGACGGATCTGGCTGATAACTCGAGTTATCAGCCAGATCCGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173781.4-169s21c1
Sequence:GTACCGGTGATCACGAGGTTCATGTATGCTCGAGCATACATGAACCTCGTGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-1129s21c1
Sequence:GTACCGGGAACTGTGTGTCACCTCTATTCTCGAGAATAGAGGTGACACACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173781.3-1261s1c1
Sequence:CCGGCCACAGTCAAATCCAACTTTACTCGAGTAAAGTTGGATTTGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-221s1c1
Sequence:CCGGCGGGATTGACTTCTTGTCAAACTCGAGTTTGACAAGAAGTCAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-348s1c1
Sequence:CCGGGCTGTGGTGGTATATGACATTCTCGAGAATGTCATATACCACCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-349s1c1
Sequence:CCGGCTGTGGTGGTATATGACATTACTCGAGTAATGTCATATACCACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-386s1c1
Sequence:CCGGCCAGCAGACTTCTAAATGGATCTCGAGATCCATTTAGAAGTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-887s21c1
Sequence:GTACCGGCTTAACAGCTGTTACCTAAACCTCGAGGTTTAGGTAACAGCTGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173781
RAB6B MISSION shRNA shRNA Plasmid DNA
RAB6B, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-791s21c1
Sequence:GTACCGGATCAAGACTGGAGGATCTTTCCTCGAGGAAAGATCCTCCAGTCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173781.4-461s21c1
Sequence:GTACCGGCAAGACGGATCTGGCTGATAACTCGAGTTATCAGCCAGATCCGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173781.4-169s21c1
Sequence:GTACCGGTGATCACGAGGTTCATGTATGCTCGAGCATACATGAACCTCGTGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-1129s21c1
Sequence:GTACCGGGAACTGTGTGTCACCTCTATTCTCGAGAATAGAGGTGACACACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173781.3-1261s1c1
Sequence:CCGGCCACAGTCAAATCCAACTTTACTCGAGTAAAGTTGGATTTGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-221s1c1
Sequence:CCGGCGGGATTGACTTCTTGTCAAACTCGAGTTTGACAAGAAGTCAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-348s1c1
Sequence:CCGGGCTGTGGTGGTATATGACATTCTCGAGAATGTCATATACCACCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-349s1c1
Sequence:CCGGCTGTGGTGGTATATGACATTACTCGAGTAATGTCATATACCACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-386s1c1
Sequence:CCGGCCAGCAGACTTCTAAATGGATCTCGAGATCCATTTAGAAGTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-887s21c1
Sequence:GTACCGGCTTAACAGCTGTTACCTAAACCTCGAGGTTTAGGTAACAGCTGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173781
RAB6B MISSION shRNA Lentiviral Transduction Particles
RAB6B, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-791s21c1
Sequence:GTACCGGATCAAGACTGGAGGATCTTTCCTCGAGGAAAGATCCTCCAGTCTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173781.4-461s21c1
Sequence:GTACCGGCAAGACGGATCTGGCTGATAACTCGAGTTATCAGCCAGATCCGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173781.4-169s21c1
Sequence:GTACCGGTGATCACGAGGTTCATGTATGCTCGAGCATACATGAACCTCGTGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-1129s21c1
Sequence:GTACCGGGAACTGTGTGTCACCTCTATTCTCGAGAATAGAGGTGACACACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173781.3-1261s1c1
Sequence:CCGGCCACAGTCAAATCCAACTTTACTCGAGTAAAGTTGGATTTGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-221s1c1
Sequence:CCGGCGGGATTGACTTCTTGTCAAACTCGAGTTTGACAAGAAGTCAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-348s1c1
Sequence:CCGGGCTGTGGTGGTATATGACATTCTCGAGAATGTCATATACCACCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-349s1c1
Sequence:CCGGCTGTGGTGGTATATGACATTACTCGAGTAATGTCATATACCACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173781.3-386s1c1
Sequence:CCGGCCAGCAGACTTCTAAATGGATCTCGAGATCCATTTAGAAGTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173781.4-887s21c1
Sequence:GTACCGGCTTAACAGCTGTTACCTAAACCTCGAGGTTTAGGTAACAGCTGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016577
VALIDATED
RAB6B MISSION shRNA Bacterial Glycerol Stock
RAB6B, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-759s21c1
Sequence:CCGGCAAGACGGACCTGGCTGATAACTCGAGTTATCAGCCAGGTCCGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-815s21c1
Sequence:CCGGCCAAAGAACTGAGCGTCATGTCTCGAGACATGACGCTCAGTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-652s21c1
Sequence:CCGGGTGGTGTACGACATCACAAATCTCGAGATTTGTGATGTCGTACACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-947s21c1
Sequence:CCGGTCGACATCAAGCTGGACAAACCTCGAGGTTTGTCCAGCTTGATGTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-482s21c1
Sequence:CCGGTGTACGACAGCTTCGACAACACTCGAGTGTTGTCGAAGCTGTCGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-680s21c1
Sequence:CCGGCCTTCCAACAGACCTCTAAGTCTCGAGACTTAGAGGTCTGTTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-1004s21c1
Sequence:CCGGGCTAATGCAGAGCCGACCTGTCTCGAGACAGGTCGGCTCTGCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-511s21c1
Sequence:CCGGGCAACCATTGGGATTGACTTCCTCGAGGAAGTCAATCCCAATGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-782s21c1
Sequence:CCGGGGCAGATAACCATCGAGGAGGCTCGAGCCTCCTCGATGGTTATCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-418s1c1
Sequence:CCGGGTCTCTGATTACGAGGTTCATCTCGAGATGAACCTCGTAATCAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-901s1c1
Sequence:CCGGGATCGACATCAAGCTGGACAACTCGAGTTGTCCAGCTTGATGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-772s1c1
Sequence:CCGGCAAAGAACTGAGCGTCATGTTCTCGAGAACATGACGCTCAGTTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-436s1c1
Sequence:CCGGCATGTACGACAGCTTCGACAACTCGAGTTGTCGAAGCTGTCGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016577.1-613s1c1
Sequence:CCGGGTACGACATCACAAATCTCAACTCGAGTTGAGATTTGTGATGTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016577
VALIDATED
RAB6B MISSION shRNA shRNA Plasmid DNA
RAB6B, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-759s21c1
Sequence:CCGGCAAGACGGACCTGGCTGATAACTCGAGTTATCAGCCAGGTCCGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-815s21c1
Sequence:CCGGCCAAAGAACTGAGCGTCATGTCTCGAGACATGACGCTCAGTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-652s21c1
Sequence:CCGGGTGGTGTACGACATCACAAATCTCGAGATTTGTGATGTCGTACACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-947s21c1
Sequence:CCGGTCGACATCAAGCTGGACAAACCTCGAGGTTTGTCCAGCTTGATGTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-482s21c1
Sequence:CCGGTGTACGACAGCTTCGACAACACTCGAGTGTTGTCGAAGCTGTCGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-680s21c1
Sequence:CCGGCCTTCCAACAGACCTCTAAGTCTCGAGACTTAGAGGTCTGTTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-1004s21c1
Sequence:CCGGGCTAATGCAGAGCCGACCTGTCTCGAGACAGGTCGGCTCTGCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-511s21c1
Sequence:CCGGGCAACCATTGGGATTGACTTCCTCGAGGAAGTCAATCCCAATGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-782s21c1
Sequence:CCGGGGCAGATAACCATCGAGGAGGCTCGAGCCTCCTCGATGGTTATCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-418s1c1
Sequence:CCGGGTCTCTGATTACGAGGTTCATCTCGAGATGAACCTCGTAATCAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-901s1c1
Sequence:CCGGGATCGACATCAAGCTGGACAACTCGAGTTGTCCAGCTTGATGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-772s1c1
Sequence:CCGGCAAAGAACTGAGCGTCATGTTCTCGAGAACATGACGCTCAGTTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-436s1c1
Sequence:CCGGCATGTACGACAGCTTCGACAACTCGAGTTGTCGAAGCTGTCGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016577.1-613s1c1
Sequence:CCGGGTACGACATCACAAATCTCAACTCGAGTTGAGATTTGTGATGTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016577
VALIDATED
RAB6B MISSION shRNA Lentiviral Transduction Particles
RAB6B, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-759s21c1
Sequence:CCGGCAAGACGGACCTGGCTGATAACTCGAGTTATCAGCCAGGTCCGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-815s21c1
Sequence:CCGGCCAAAGAACTGAGCGTCATGTCTCGAGACATGACGCTCAGTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-652s21c1
Sequence:CCGGGTGGTGTACGACATCACAAATCTCGAGATTTGTGATGTCGTACACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-947s21c1
Sequence:CCGGTCGACATCAAGCTGGACAAACCTCGAGGTTTGTCCAGCTTGATGTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-482s21c1
Sequence:CCGGTGTACGACAGCTTCGACAACACTCGAGTGTTGTCGAAGCTGTCGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-680s21c1
Sequence:CCGGCCTTCCAACAGACCTCTAAGTCTCGAGACTTAGAGGTCTGTTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-1004s21c1
Sequence:CCGGGCTAATGCAGAGCCGACCTGTCTCGAGACAGGTCGGCTCTGCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-511s21c1
Sequence:CCGGGCAACCATTGGGATTGACTTCCTCGAGGAAGTCAATCCCAATGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016577.3-782s21c1
Sequence:CCGGGGCAGATAACCATCGAGGAGGCTCGAGCCTCCTCGATGGTTATCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-418s1c1
Sequence:CCGGGTCTCTGATTACGAGGTTCATCTCGAGATGAACCTCGTAATCAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-901s1c1
Sequence:CCGGGATCGACATCAAGCTGGACAACTCGAGTTGTCCAGCTTGATGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-772s1c1
Sequence:CCGGCAAAGAACTGAGCGTCATGTTCTCGAGAACATGACGCTCAGTTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016577.1-436s1c1
Sequence:CCGGCATGTACGACAGCTTCGACAACTCGAGTTGTCGAAGCTGTCGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_016577.1-613s1c1
Sequence:CCGGGTACGACATCACAAATCTCAACTCGAGTTGAGATTTGTGATGTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)