EMAIL THIS PAGE TO A FRIEND

RAB6C

RAB6C, member RAS oncogene family

115 Gene Product Result for
Synonyms: WTH3
Species: Human RAB6C(84084)
UniProtKB ID: Q9H0N0, Q53RU3, Q6FIF7, Q9P128
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032144 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032144 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047918 predicted 1007
2 SASI_Hs01_00047920 predicted 1082
3 SASI_Hs01_00047919 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032144
VALIDATED
RAB6C MISSION shRNA Bacterial Glycerol Stock
RAB6C, member RAS oncogene family
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-752s21c1
Sequence:GTACCGGTCATTCCAGCAAACTACAAAGCTCGAGCTTTGTAGTTTGCTGGAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-533s21c1
Sequence:GTACCGGACATCTTTGATCACCAGATTCCTCGAGGAATCTGGTGATCAAAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-1206s21c1
Sequence:CCGGTCTCGTGGAGGTGATCTATTACTCGAGTAATAGATCACCTCCACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-719s21c1
Sequence:CCGGGCTGTAGTAGTTTACGATATCCTCGAGGATATCGTAAACTACTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-892s21c1
Sequence:CCGGAGGGCTGAATGTTACGTTTATCTCGAGATAAACGTAACATTCAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032144.2-1560s21c1
Sequence:GTACCGGGCCCACTGGAATTATCCTTTACTCGAGTAAAGGATAATTCCAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-1009s21c1
Sequence:GTACCGGAGAAGACATGAGTGACATAAACTCGAGTTTATGTCACTCATGTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032144.2-1613s21c1
Sequence:GTACCGGACCAAGATGTCCAGAATTATTCTCGAGAATAATTCTGGACATCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-814s21c1
Sequence:GTACCGGCATCACGCTAGTAGGAAATAGCTCGAGCTATTTCCTACTAGCGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-620s21c1
Sequence:GTACCGGTACTTGGAGGATGGAACAATCCTCGAGGATTGTTCCATCCTCCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-1091s1c1
Sequence:CCGGGTCATCTTCAACCCTTCCTCACTCGAGTGAGGAAGGGTTGAAGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-488s1c1
Sequence:CCGGGAGGAAATTCAAGCTGGTGTTCTCGAGAACACCAGCTTGAATTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-585s1c1
Sequence:CCGGGCAATAATTGGCATTGACTTTCTCGAGAAAGTCAATGCCAATTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-907s1c1
Sequence:CCGGCGTTTATTGAAACTAGGGCAACTCGAGTTGCCCTAGTTTCAATAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-524s1c1
Sequence:CCGGCGTTGCAAAGACATCTTTGATCTCGAGATCAAAGATGTCTTTGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032144
VALIDATED
RAB6C MISSION shRNA shRNA Plasmid DNA
RAB6C, member RAS oncogene family
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-752s21c1
Sequence:GTACCGGTCATTCCAGCAAACTACAAAGCTCGAGCTTTGTAGTTTGCTGGAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-533s21c1
Sequence:GTACCGGACATCTTTGATCACCAGATTCCTCGAGGAATCTGGTGATCAAAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-1206s21c1
Sequence:CCGGTCTCGTGGAGGTGATCTATTACTCGAGTAATAGATCACCTCCACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-719s21c1
Sequence:CCGGGCTGTAGTAGTTTACGATATCCTCGAGGATATCGTAAACTACTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-892s21c1
Sequence:CCGGAGGGCTGAATGTTACGTTTATCTCGAGATAAACGTAACATTCAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032144.2-1560s21c1
Sequence:GTACCGGGCCCACTGGAATTATCCTTTACTCGAGTAAAGGATAATTCCAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-1009s21c1
Sequence:GTACCGGAGAAGACATGAGTGACATAAACTCGAGTTTATGTCACTCATGTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032144.2-1613s21c1
Sequence:GTACCGGACCAAGATGTCCAGAATTATTCTCGAGAATAATTCTGGACATCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-814s21c1
Sequence:GTACCGGCATCACGCTAGTAGGAAATAGCTCGAGCTATTTCCTACTAGCGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-620s21c1
Sequence:GTACCGGTACTTGGAGGATGGAACAATCCTCGAGGATTGTTCCATCCTCCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-1091s1c1
Sequence:CCGGGTCATCTTCAACCCTTCCTCACTCGAGTGAGGAAGGGTTGAAGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-488s1c1
Sequence:CCGGGAGGAAATTCAAGCTGGTGTTCTCGAGAACACCAGCTTGAATTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-585s1c1
Sequence:CCGGGCAATAATTGGCATTGACTTTCTCGAGAAAGTCAATGCCAATTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-907s1c1
Sequence:CCGGCGTTTATTGAAACTAGGGCAACTCGAGTTGCCCTAGTTTCAATAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-524s1c1
Sequence:CCGGCGTTGCAAAGACATCTTTGATCTCGAGATCAAAGATGTCTTTGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032144
VALIDATED
RAB6C MISSION shRNA Lentiviral Transduction Particles
RAB6C, member RAS oncogene family
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-752s21c1
Sequence:GTACCGGTCATTCCAGCAAACTACAAAGCTCGAGCTTTGTAGTTTGCTGGAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-533s21c1
Sequence:GTACCGGACATCTTTGATCACCAGATTCCTCGAGGAATCTGGTGATCAAAGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-1206s21c1
Sequence:CCGGTCTCGTGGAGGTGATCTATTACTCGAGTAATAGATCACCTCCACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032144.2-719s21c1
Sequence:CCGGGCTGTAGTAGTTTACGATATCCTCGAGGATATCGTAAACTACTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-892s21c1
Sequence:CCGGAGGGCTGAATGTTACGTTTATCTCGAGATAAACGTAACATTCAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032144.2-1560s21c1
Sequence:GTACCGGGCCCACTGGAATTATCCTTTACTCGAGTAAAGGATAATTCCAGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-1009s21c1
Sequence:GTACCGGAGAAGACATGAGTGACATAAACTCGAGTTTATGTCACTCATGTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032144.2-1613s21c1
Sequence:GTACCGGACCAAGATGTCCAGAATTATTCTCGAGAATAATTCTGGACATCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-814s21c1
Sequence:GTACCGGCATCACGCTAGTAGGAAATAGCTCGAGCTATTTCCTACTAGCGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032144.2-620s21c1
Sequence:GTACCGGTACTTGGAGGATGGAACAATCCTCGAGGATTGTTCCATCCTCCAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-1091s1c1
Sequence:CCGGGTCATCTTCAACCCTTCCTCACTCGAGTGAGGAAGGGTTGAAGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-488s1c1
Sequence:CCGGGAGGAAATTCAAGCTGGTGTTCTCGAGAACACCAGCTTGAATTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-585s1c1
Sequence:CCGGGCAATAATTGGCATTGACTTTCTCGAGAAAGTCAATGCCAATTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-907s1c1
Sequence:CCGGCGTTTATTGAAACTAGGGCAACTCGAGTTGCCCTAGTTTCAATAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032144.1-524s1c1
Sequence:CCGGCGTTGCAAAGACATCTTTGATCTCGAGATCAAAGATGTCTTTGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)