EMAIL THIS PAGE TO A FRIEND

RAB7A

RAB7A, member RAS oncogene family

133 Gene Product Result for
Synonyms: PRO2706 RAB7
UniProtKB ID: P51149, A8K3V6, Q9NWJ0, Q9UPB0
Gene ID:
Human(7879) Summary: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. [provided by RefSeq, Jul 2008]
Rat(29448) RAB7A, member RAS oncogene family
cow(509970) RAB7A, member RAS oncogene family
sheep(100145880) RAB7A, member RAS oncogene family
Domestic Rabbit(100008682) RAB7A, member RAS oncogene family
domestic guinea pig(100721839) RAB7A, member RAS oncogene family
Thale Cress(816724) RAB GTPase-like protein 7A
chicken(416016) RAB7A, member RAS oncogene family
dog(404007) RAB7A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004637 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053221 MISSION® esiRNA esiRNA human RAB7A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004637 Rosetta Predictions human pricing
NM_023950 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104357 predicted 785
2 SASI_Hs01_00104360 predicted 776
3 SASI_Hs01_00104361 predicted 464
4 SASI_Hs02_00338038 predicted 795
5 SASI_Hs02_00338039 predicted 741
6 SASI_Hs02_00338040 predicted 521
7 SASI_Hs02_00338041 predicted 749
8 SASI_Hs02_00338042 predicted 469
9 SASI_Hs02_00338043 predicted 789
10 SASI_Hs02_00338044 predicted 585
11 SASI_Hs01_00104352 predicted 387
12 SASI_Hs01_00104353 predicted 337
13 SASI_Hs01_00104354 predicted 266
14 SASI_Hs01_00104355 predicted 281
15 SASI_Hs01_00104356 predicted 384
16 SASI_Hs01_00104358 predicted 244
17 SASI_Hs01_00104359 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073737 predicted 291
2 SASI_Rn01_00073738 predicted 681
3 SASI_Rn01_00073739 predicted 276
4 SASI_Rn01_00073740 predicted 309
5 SASI_Rn01_00073741 predicted 323
6 SASI_Rn02_00263748 predicted 308
7 SASI_Rn01_00073744 predicted 530
8 SASI_Rn01_00073745 predicted 646
9 SASI_Rn01_00073746 predicted 679
10 SASI_Rn02_00263749 predicted 624
11 SASI_Rn01_00073742 predicted 309
12 SASI_Rn01_00073743 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004637
VALIDATED
RAB7A MISSION shRNA Bacterial Glycerol Stock
RAB7A, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004637.5-1795s1c1
Sequence:CCGGGCAATGGATAAATTGCCGTTACTCGAGTAACGGCAATTTATCCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_004637.5-603s1c1
Sequence:CCGGGAAACAAGATTGACCTCGAAACTCGAGTTTCGAGGTCAATCTTGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-309s21c1
Sequence:GTACCGGACCAGTATGTGAATAAGAAATCTCGAGATTTCTTATTCACATACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-262s21c1
Sequence:GTACCGGGGTTATCATCCTGGGAGATTCCTCGAGGAATCTCCCAGGATGATAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004637.5-781s1c1
Sequence:CCGGCAACGAATTTCCTGAACCTATCTCGAGATAGGTTCAGGAAATTCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004637.5-586s1c1
Sequence:CCGGCCCATTTGTTGTGTTGGGAAACTCGAGTTTCCCAACACAACAAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004637.5-347s1c1
Sequence:CCGGGCCACAATAGGAGCTGACTTTCTCGAGAAAGTCAGCTCCTATTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-1798s21c1
Sequence:CCGGATGGATAAATTGCCGTTATTTCTCGAGAAATAACGGCAATTTATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-477s21c1
Sequence:CCGGACTGCTGCGTTCTGGTATTTGCTCGAGCAAATACCAGAACGCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-904s21c1
Sequence:GTACCGGACGTAGGCCTTCAACACAATTCTCGAGAATTGTGTTGAAGGCCTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-396s21c1
Sequence:CCGGGGCTAGTCACAATGCAGATATCTCGAGATATCTGCATTGTGACTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-783s21c1
Sequence:GTACCGGACGAATTTCCTGAACCTATCACTCGAGTGATAGGTTCAGGAAATTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004637.5-336s21c1
Sequence:GTACCGGATCAGTACAAAGCCACAATAGCTCGAGCTATTGTGGCTTTGTACTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-531s21c1
Sequence:GTACCGGATAGCTGGAGAGATGAGTTTCCTCGAGGAAACTCATCTCTCCAGCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004637
VALIDATED
RAB7A MISSION shRNA shRNA Plasmid DNA
RAB7A, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004637.5-1795s1c1
Sequence:CCGGGCAATGGATAAATTGCCGTTACTCGAGTAACGGCAATTTATCCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_004637.5-603s1c1
Sequence:CCGGGAAACAAGATTGACCTCGAAACTCGAGTTTCGAGGTCAATCTTGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-309s21c1
Sequence:GTACCGGACCAGTATGTGAATAAGAAATCTCGAGATTTCTTATTCACATACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-262s21c1
Sequence:GTACCGGGGTTATCATCCTGGGAGATTCCTCGAGGAATCTCCCAGGATGATAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004637.5-781s1c1
Sequence:CCGGCAACGAATTTCCTGAACCTATCTCGAGATAGGTTCAGGAAATTCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004637.5-586s1c1
Sequence:CCGGCCCATTTGTTGTGTTGGGAAACTCGAGTTTCCCAACACAACAAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004637.5-347s1c1
Sequence:CCGGGCCACAATAGGAGCTGACTTTCTCGAGAAAGTCAGCTCCTATTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-1798s21c1
Sequence:CCGGATGGATAAATTGCCGTTATTTCTCGAGAAATAACGGCAATTTATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-477s21c1
Sequence:CCGGACTGCTGCGTTCTGGTATTTGCTCGAGCAAATACCAGAACGCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-904s21c1
Sequence:GTACCGGACGTAGGCCTTCAACACAATTCTCGAGAATTGTGTTGAAGGCCTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-396s21c1
Sequence:CCGGGGCTAGTCACAATGCAGATATCTCGAGATATCTGCATTGTGACTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-783s21c1
Sequence:GTACCGGACGAATTTCCTGAACCTATCACTCGAGTGATAGGTTCAGGAAATTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004637.5-336s21c1
Sequence:GTACCGGATCAGTACAAAGCCACAATAGCTCGAGCTATTGTGGCTTTGTACTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-531s21c1
Sequence:GTACCGGATAGCTGGAGAGATGAGTTTCCTCGAGGAAACTCATCTCTCCAGCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004637
VALIDATED
RAB7A MISSION shRNA Lentiviral Transduction Particles
RAB7A, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004637.5-1795s1c1
Sequence:CCGGGCAATGGATAAATTGCCGTTACTCGAGTAACGGCAATTTATCCATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_004637.5-603s1c1
Sequence:CCGGGAAACAAGATTGACCTCGAAACTCGAGTTTCGAGGTCAATCTTGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-309s21c1
Sequence:GTACCGGACCAGTATGTGAATAAGAAATCTCGAGATTTCTTATTCACATACTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-262s21c1
Sequence:GTACCGGGGTTATCATCCTGGGAGATTCCTCGAGGAATCTCCCAGGATGATAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004637.5-781s1c1
Sequence:CCGGCAACGAATTTCCTGAACCTATCTCGAGATAGGTTCAGGAAATTCGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004637.5-586s1c1
Sequence:CCGGCCCATTTGTTGTGTTGGGAAACTCGAGTTTCCCAACACAACAAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004637.5-347s1c1
Sequence:CCGGGCCACAATAGGAGCTGACTTTCTCGAGAAAGTCAGCTCCTATTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-1798s21c1
Sequence:CCGGATGGATAAATTGCCGTTATTTCTCGAGAAATAACGGCAATTTATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-477s21c1
Sequence:CCGGACTGCTGCGTTCTGGTATTTGCTCGAGCAAATACCAGAACGCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-904s21c1
Sequence:GTACCGGACGTAGGCCTTCAACACAATTCTCGAGAATTGTGTTGAAGGCCTACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-396s21c1
Sequence:CCGGGGCTAGTCACAATGCAGATATCTCGAGATATCTGCATTGTGACTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-783s21c1
Sequence:GTACCGGACGAATTTCCTGAACCTATCACTCGAGTGATAGGTTCAGGAAATTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004637.5-336s21c1
Sequence:GTACCGGATCAGTACAAAGCCACAATAGCTCGAGCTATTGTGGCTTTGTACTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004637.5-531s21c1
Sequence:GTACCGGATAGCTGGAGAGATGAGTTTCCTCGAGGAAACTCATCTCTCCAGCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)