EMAIL THIS PAGE TO A FRIEND

RAB7B

RAB7B, member RAS oncogene family

102 Gene Product Result for
Synonyms: RAB7
UniProtKB ID: Q96AH8
Gene ID:
Rat(501854) Rab7b, member RAS oncogene family
Thale Cress(821415) Ras-related protein RABG3f
cow(538050) RAB7B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177403 Rosetta Predictions human pricing
NM_001109328 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167273 predicted 431
2 SASI_Hs01_00167274 predicted 409
3 SASI_Hs01_00167275 predicted 844
4 SASI_Hs01_00167276 predicted 745
5 SASI_Hs01_00167277 predicted 1190
6 SASI_Hs01_00167279 predicted 1095
7 SASI_Hs01_00167280 predicted 802
8 SASI_Hs01_00167282 predicted 784
9 SASI_Hs02_00369305 predicted 1086
10 SASI_Hs02_00369306 predicted 687
11 SASI_Hs01_00167278 predicted 441
12 SASI_Hs01_00167281 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247344 predicted 860
2 SASI_Rn02_00247345 predicted 421
3 SASI_Rn02_00247346 predicted 552
4 SASI_Rn02_00247347 predicted 469
5 SASI_Rn02_00247348 predicted 581
6 SASI_Rn02_00247349 predicted 552
7 SASI_Rn02_00247350 predicted 291
8 SASI_Rn02_00247351 predicted 657
9 SASI_Rn02_00247352 predicted 599
10 SASI_Rn02_00247353 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177403
RAB7B MISSION shRNA Bacterial Glycerol Stock
RAB7B, member RAS oncogene family
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-707s1c1
Sequence:CCGGGCTGGTGTAGAGAGAAAGATACTCGAGTATCTTTCTCTCTACACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-360s1c1
Sequence:CCGGCCCTCACCAATATGTGCACAACTCGAGTTGTGCACATATTGGTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-319s1c1
Sequence:CCGGCTCATTATCGTCGGAGCCATTCTCGAGAATGGCTCCGACGATAATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-745s1c1
Sequence:CCGGAGTGCCAAGAATGACATCAATCTCGAGATTGATGTCATTCTTGGCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-450s1c1
Sequence:CCGGCACAACTTTGAAGTTACAGATCTCGAGATCTGTAACTTCAAAGTTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177403
RAB7B MISSION shRNA shRNA Plasmid DNA
RAB7B, member RAS oncogene family
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-707s1c1
Sequence:CCGGGCTGGTGTAGAGAGAAAGATACTCGAGTATCTTTCTCTCTACACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-360s1c1
Sequence:CCGGCCCTCACCAATATGTGCACAACTCGAGTTGTGCACATATTGGTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-319s1c1
Sequence:CCGGCTCATTATCGTCGGAGCCATTCTCGAGAATGGCTCCGACGATAATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-745s1c1
Sequence:CCGGAGTGCCAAGAATGACATCAATCTCGAGATTGATGTCATTCTTGGCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-450s1c1
Sequence:CCGGCACAACTTTGAAGTTACAGATCTCGAGATCTGTAACTTCAAAGTTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177403
RAB7B MISSION shRNA Lentiviral Transduction Particles
RAB7B, member RAS oncogene family
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-707s1c1
Sequence:CCGGGCTGGTGTAGAGAGAAAGATACTCGAGTATCTTTCTCTCTACACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-360s1c1
Sequence:CCGGCCCTCACCAATATGTGCACAACTCGAGTTGTGCACATATTGGTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-319s1c1
Sequence:CCGGCTCATTATCGTCGGAGCCATTCTCGAGAATGGCTCCGACGATAATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-745s1c1
Sequence:CCGGAGTGCCAAGAATGACATCAATCTCGAGATTGATGTCATTCTTGGCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177403.3-450s1c1
Sequence:CCGGCACAACTTTGAAGTTACAGATCTCGAGATCTGTAACTTCAAAGTTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)