EMAIL THIS PAGE TO A FRIEND

RAB8A

RAB8A, member RAS oncogene family

81 Gene Product Result for
Synonyms: MEL RAB8
UniProtKB ID: P61006, P24407, Q6FHV5
Gene ID:
Human(4218) Summary: The protein encoded by this gene is a member of the RAS superfamily which are small GTP/GDP-binding proteins with an average size of 200 amino acids. The RAS-related proteins of the RAB/YPT family may play a role in the transport of proteins from the endoplasmic reticulum to the Golgi and the plasma membrane. This protein shares 97%, 96%, and 51% similarity with the dog RAB8, mouse MEL, and mouse YPT1 proteins, respectively and contains the 4 GTP/GDP-binding sites that are present in all the RAS proteins. The putative effector-binding site of this protein is similar to that of the RAB/YPT proteins. However, this protein contains a C-terminal CAAX motif that is characteristic of many RAS superfamily members but which is not found in YPT1 and the majority of RAB proteins. Although this gene was isolated as a transforming gene from a melanoma cell line, no linkage between MEL and malignant melanoma has been demonstrable. This oncogene is located 800 kb distal to MY09B on chromosome 19p13.1. [provided by RefSeq, Jul 2008]
Mouse(17274) RAB8A, member RAS oncogene family
Rat(117103) RAB8A, member RAS oncogene family
Thale Cress(823749) small GTP-binding protein ARA3
chicken(428352) RAB8A, member RAS oncogene family
dog(403773) RAB8A, member RAS oncogene family
domestic cat(101092668) RAB8A, member RAS oncogene family
Zebrafish(571897) RAB8A, member RAS oncogene family
naked mole-rat(101709178) RAB8A, member RAS oncogene family
domestic guinea pig(100734132) RAB8A, member RAS oncogene family
cow(100125881) RAB8A, member RAS oncogene family
sheep(100302063) RAB8A, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005370 Rosetta Predictions human pricing
NM_053998 Rosetta Predictions rat pricing
NM_023126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339466 predicted 665
2 SASI_Hs01_00209134 predicted 1094
3 SASI_Hs01_00209135 predicted 820
4 SASI_Hs01_00209138 predicted 770
5 SASI_Hs01_00209139 predicted 1088
6 SASI_Hs02_00339467 predicted 1175
7 SASI_Hs01_00209140 predicted 370
8 SASI_Hs01_00209141 predicted 362
9 SASI_Hs02_00339468 predicted 380
10 SASI_Hs02_00339469 predicted 432
11 SASI_Hs01_00209133 predicted 514
12 SASI_Hs01_00209136 predicted 475
13 SASI_Hs01_00209137 predicted 289
14 SASI_Hs01_00209142 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266996 predicted 287
2 SASI_Rn02_00266997 predicted 447
3 SASI_Rn01_00085730 predicted 621
4 SASI_Rn02_00266998 predicted 763
5 SASI_Rn02_00266999 predicted 709
6 SASI_Rn02_00267000 predicted 1009
7 SASI_Rn01_00085731 predicted 776
8 SASI_Rn02_00267001 predicted 1018
9 SASI_Rn02_00267002 predicted 246
10 SASI_Rn01_00085734 predicted 727
11 SASI_Rn01_00085732 predicted 505
12 SASI_Rn01_00085733 predicted 337
13 SASI_Rn01_00085735 predicted 201
14 SASI_Rn01_00085736 predicted 505
15 SASI_Rn01_00085737 predicted 349
16 SASI_Rn01_00085738 predicted 320
17 SASI_Rn01_00085739 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188200 predicted 1213
2 SASI_Mm01_00188201 predicted 875
3 SASI_Mm01_00188202 predicted 438
4 SASI_Mm01_00188203 predicted 400
5 SASI_Mm02_00326824 predicted 608
6 SASI_Mm01_00188204 predicted 295
7 SASI_Mm01_00188205 predicted 244
8 SASI_Mm01_00188207 predicted 457
9 SASI_Mm01_00188208 predicted 715
10 SASI_Mm02_00326825 predicted 266
11 SASI_Mm01_00188199 predicted 267
12 SASI_Mm01_00188206 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005370
VALIDATED
RAB8A MISSION shRNA Bacterial Glycerol Stock
RAB8A, member RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005370.4-1088s21c1
Sequence:GTACCGGGCCCACCCACACGTTGTATATCTCGAGATATACAACGTGTGGGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-376s21c1
Sequence:CCGGCTCGATGGCAAGAGAATTAAACTCGAGTTTAATTCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005370.4-498s21c1
Sequence:CCGGCGAGAAGTCCTTCGACAACATCTCGAGATGTTGTCGAAGGACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-520s21c1
Sequence:CCGGCGGAACTGGATTCGCAACATTCTCGAGAATGTTGCGAATCCAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005370.4-645s21c1
Sequence:CCGGCGACTATGGAATCAAGTTCATCTCGAGATGAACTTGATTCCATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-716s1c1
Sequence:CCGGTCGCCAGAGATATCAAAGCAACTCGAGTTGCTTTGATATCTCTGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-645s1c1
Sequence:CCGGCGACTATGGAATCAAGTTCATCTCGAGATGAACTTGATTCCATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-376s1c1
Sequence:CCGGCTCGATGGCAAGAGAATTAAACTCGAGTTTAATTCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-520s1c1
Sequence:CCGGCGGAACTGGATTCGCAACATTCTCGAGAATGTTGCGAATCCAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005370.4-498s1c1
Sequence:CCGGCGAGAAGTCCTTCGACAACATCTCGAGATGTTGTCGAAGGACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-716s21c1
Sequence:CCGGTCGCCAGAGATATCAAAGCAACTCGAGTTGCTTTGATATCTCTGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005370
VALIDATED
RAB8A MISSION shRNA shRNA Plasmid DNA
RAB8A, member RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005370.4-1088s21c1
Sequence:GTACCGGGCCCACCCACACGTTGTATATCTCGAGATATACAACGTGTGGGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-376s21c1
Sequence:CCGGCTCGATGGCAAGAGAATTAAACTCGAGTTTAATTCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005370.4-498s21c1
Sequence:CCGGCGAGAAGTCCTTCGACAACATCTCGAGATGTTGTCGAAGGACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-520s21c1
Sequence:CCGGCGGAACTGGATTCGCAACATTCTCGAGAATGTTGCGAATCCAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005370.4-645s21c1
Sequence:CCGGCGACTATGGAATCAAGTTCATCTCGAGATGAACTTGATTCCATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-716s1c1
Sequence:CCGGTCGCCAGAGATATCAAAGCAACTCGAGTTGCTTTGATATCTCTGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-645s1c1
Sequence:CCGGCGACTATGGAATCAAGTTCATCTCGAGATGAACTTGATTCCATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-376s1c1
Sequence:CCGGCTCGATGGCAAGAGAATTAAACTCGAGTTTAATTCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-520s1c1
Sequence:CCGGCGGAACTGGATTCGCAACATTCTCGAGAATGTTGCGAATCCAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005370.4-498s1c1
Sequence:CCGGCGAGAAGTCCTTCGACAACATCTCGAGATGTTGTCGAAGGACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-716s21c1
Sequence:CCGGTCGCCAGAGATATCAAAGCAACTCGAGTTGCTTTGATATCTCTGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005370
VALIDATED
RAB8A MISSION shRNA Lentiviral Transduction Particles
RAB8A, member RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005370.4-1088s21c1
Sequence:GTACCGGGCCCACCCACACGTTGTATATCTCGAGATATACAACGTGTGGGTGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-376s21c1
Sequence:CCGGCTCGATGGCAAGAGAATTAAACTCGAGTTTAATTCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005370.4-498s21c1
Sequence:CCGGCGAGAAGTCCTTCGACAACATCTCGAGATGTTGTCGAAGGACTTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-520s21c1
Sequence:CCGGCGGAACTGGATTCGCAACATTCTCGAGAATGTTGCGAATCCAGTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005370.4-645s21c1
Sequence:CCGGCGACTATGGAATCAAGTTCATCTCGAGATGAACTTGATTCCATAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-716s1c1
Sequence:CCGGTCGCCAGAGATATCAAAGCAACTCGAGTTGCTTTGATATCTCTGGCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-645s1c1
Sequence:CCGGCGACTATGGAATCAAGTTCATCTCGAGATGAACTTGATTCCATAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-376s1c1
Sequence:CCGGCTCGATGGCAAGAGAATTAAACTCGAGTTTAATTCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005370.4-520s1c1
Sequence:CCGGCGGAACTGGATTCGCAACATTCTCGAGAATGTTGCGAATCCAGTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005370.4-498s1c1
Sequence:CCGGCGAGAAGTCCTTCGACAACATCTCGAGATGTTGTCGAAGGACTTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005370.4-716s21c1
Sequence:CCGGTCGCCAGAGATATCAAAGCAACTCGAGTTGCTTTGATATCTCTGGCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023126
VALIDATED
RAB8A MISSION shRNA Bacterial Glycerol Stock
RAB8A, member RAS oncogene family
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023126.2-1490s21c1
Sequence:CCGGCCATGAAATGAATCTGTCTTTCTCGAGAAAGACAGATTCATTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-313s21c1
Sequence:CCGGCTCGATGGCAAGAGGATTAAACTCGAGTTTAATCCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-252s21c1
Sequence:CCGGCGCCTTCAACTCCACATTCATCTCGAGATGAATGTGGAGTTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-420s1c1
Sequence:CCGGCTACGACATTACCAATGAGAACTCGAGTTCTCATTGGTAATGTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-1490s1c1
Sequence:CCGGCCATGAAATGAATCTGTCTTTCTCGAGAAAGACAGATTCATTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-252s1c1
Sequence:CCGGCGCCTTCAACTCCACATTCATCTCGAGATGAATGTGGAGTTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-313s1c1
Sequence:CCGGCTCGATGGCAAGAGGATTAAACTCGAGTTTAATCCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-457s1c1
Sequence:CCGGCGGAATTGGATTCGGAACATTCTCGAGAATGTTCCGAATCCAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-457s21c1
Sequence:CCGGCGGAATTGGATTCGGAACATTCTCGAGAATGTTCCGAATCCAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023126
VALIDATED
RAB8A MISSION shRNA shRNA Plasmid DNA
RAB8A, member RAS oncogene family
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023126.2-1490s21c1
Sequence:CCGGCCATGAAATGAATCTGTCTTTCTCGAGAAAGACAGATTCATTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-313s21c1
Sequence:CCGGCTCGATGGCAAGAGGATTAAACTCGAGTTTAATCCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-252s21c1
Sequence:CCGGCGCCTTCAACTCCACATTCATCTCGAGATGAATGTGGAGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-420s1c1
Sequence:CCGGCTACGACATTACCAATGAGAACTCGAGTTCTCATTGGTAATGTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-1490s1c1
Sequence:CCGGCCATGAAATGAATCTGTCTTTCTCGAGAAAGACAGATTCATTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-252s1c1
Sequence:CCGGCGCCTTCAACTCCACATTCATCTCGAGATGAATGTGGAGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-313s1c1
Sequence:CCGGCTCGATGGCAAGAGGATTAAACTCGAGTTTAATCCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-457s1c1
Sequence:CCGGCGGAATTGGATTCGGAACATTCTCGAGAATGTTCCGAATCCAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-457s21c1
Sequence:CCGGCGGAATTGGATTCGGAACATTCTCGAGAATGTTCCGAATCCAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023126
VALIDATED
RAB8A MISSION shRNA Lentiviral Transduction Particles
RAB8A, member RAS oncogene family
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023126.2-1490s21c1
Sequence:CCGGCCATGAAATGAATCTGTCTTTCTCGAGAAAGACAGATTCATTTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-313s21c1
Sequence:CCGGCTCGATGGCAAGAGGATTAAACTCGAGTTTAATCCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-252s21c1
Sequence:CCGGCGCCTTCAACTCCACATTCATCTCGAGATGAATGTGGAGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-420s1c1
Sequence:CCGGCTACGACATTACCAATGAGAACTCGAGTTCTCATTGGTAATGTCGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-1490s1c1
Sequence:CCGGCCATGAAATGAATCTGTCTTTCTCGAGAAAGACAGATTCATTTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-252s1c1
Sequence:CCGGCGCCTTCAACTCCACATTCATCTCGAGATGAATGTGGAGTTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-313s1c1
Sequence:CCGGCTCGATGGCAAGAGGATTAAACTCGAGTTTAATCCTCTTGCCATCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023126.2-457s1c1
Sequence:CCGGCGGAATTGGATTCGGAACATTCTCGAGAATGTTCCGAATCCAATTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023126.2-457s21c1
Sequence:CCGGCGGAATTGGATTCGGAACATTCTCGAGAATGTTCCGAATCCAATTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)