EMAIL THIS PAGE TO A FRIEND

RAB8B

RAB8B, member RAS oncogene family

241 Gene Product Result for
UniProtKB ID: Q92930, Q5JPC4, Q9P293
Gene ID:
Human(51762) Summary: RAB proteins, like RAB8B, are low molecular mass monomeric GTPases that localize on the cytoplasmic surfaces of distinct membrane-bound organelles. RAB proteins function in intracellular vesicle transport by aiding in the docking and/or fusion of vesicles with their target membranes (summary by Chen et al., 1997 [PubMed 9030196]
Mouse(235442) RAB8B, member RAS oncogene family
Rat(266688) RAB8B, member RAS oncogene family
cow(614242) RAB8B, member RAS oncogene family
sheep(101111969) RAB8B, member RAS oncogene family
domestic guinea pig(100727085) RAB8B, member RAS oncogene family
naked mole-rat(101713515) RAB8B, member RAS oncogene family
Zebrafish(100093706) RAB8B, member RAS oncogene family
chicken(415371) RAB8B, member RAS oncogene family
dog(610601) RAB8B, member RAS oncogene family
domestic cat(101090774) RAB8B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000791 MISSION® esiRNA esiRNA targeting human RAB8B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016530 Rosetta Predictions human pricing
NM_153317 Rosetta Predictions rat pricing
NM_173413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155830 predicted 517
2 SASI_Hs01_00155831 predicted 1013
3 SASI_Hs01_00155832 predicted 507
4 SASI_Hs01_00155834 predicted 553
5 SASI_Hs01_00155835 predicted 670
6 SASI_Hs01_00155836 predicted 506
7 SASI_Hs01_00155837 predicted 235
8 SASI_Hs01_00155838 predicted 305
9 SASI_Hs01_00155839 predicted 349
10 SASI_Hs02_00349635 predicted 409
11 SASI_Hs01_00155833 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073876 predicted 204
2 SASI_Rn01_00073877 predicted 388
3 SASI_Rn01_00073878 predicted 205
4 SASI_Rn01_00073879 predicted 271
5 SASI_Rn01_00073880 predicted 477
6 SASI_Rn01_00073881 predicted 256
7 SASI_Rn01_00073882 predicted 273
8 SASI_Rn01_00073883 predicted 265
9 SASI_Rn01_00073884 predicted 272
10 SASI_Rn01_00073885 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049132 predicted 382
2 SASI_Mm01_00049133 predicted 977
3 SASI_Mm01_00049134 predicted 1160
4 SASI_Mm01_00049135 predicted 885
5 SASI_Mm01_00049136 predicted 469
6 SASI_Mm01_00049137 predicted 1172
7 SASI_Mm01_00049138 predicted 885
8 SASI_Mm01_00049139 predicted 253
9 SASI_Mm01_00049140 predicted 268
10 SASI_Mm01_00049141 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016530
VALIDATED
RAB8B MISSION shRNA Bacterial Glycerol Stock
RAB8B, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016530.1-238s1c1
Sequence:CCGGGATAGAACTAGATGGAAAGAACTCGAGTTCTTTCCATCTAGTTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016530.1-673s1c1
Sequence:CCGGCCGATCAAAGAAGACCAGTTTCTCGAGAAACTGGTCTTCTTTGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-445s1c1
Sequence:CCGGCCTGGGTAACAAATGTGATATCTCGAGATATCACATTTGTTACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-505s1c1
Sequence:CCGGGCTAGCAATTGACTATGGGATCTCGAGATCCCATAGTCAATTGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-433s1c1
Sequence:CCGGCGAAAGAATGATCCTGGGTAACTCGAGTTACCCAGGATCATTCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016530.2-443s21c1
Sequence:GTACCGGGAATGATCCTGGGTAACAAATCTCGAGATTTGTTACCCAGGATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016530.2-506s21c1
Sequence:GTACCGGAGAAGCTAGCAATTGACTATGCTCGAGCATAGTCAATTGCTAGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-1188s21c1
Sequence:GTACCGGTTACTGCCTTGGTAGCATTTACTCGAGTAAATGCTACCAAGGCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-975s21c1
Sequence:GTACCGGACCTGTTGCAGAAGCGGTTATCTCGAGATAACCGCTTCTGCAACAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-1076s21c1
Sequence:GTACCGGGTCGTGAAGTTCTAGACAAATCTCGAGATTTGTCTAGAACTTCACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016530
VALIDATED
RAB8B MISSION shRNA shRNA Plasmid DNA
RAB8B, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016530.1-238s1c1
Sequence:CCGGGATAGAACTAGATGGAAAGAACTCGAGTTCTTTCCATCTAGTTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016530.1-673s1c1
Sequence:CCGGCCGATCAAAGAAGACCAGTTTCTCGAGAAACTGGTCTTCTTTGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-445s1c1
Sequence:CCGGCCTGGGTAACAAATGTGATATCTCGAGATATCACATTTGTTACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-505s1c1
Sequence:CCGGGCTAGCAATTGACTATGGGATCTCGAGATCCCATAGTCAATTGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-433s1c1
Sequence:CCGGCGAAAGAATGATCCTGGGTAACTCGAGTTACCCAGGATCATTCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016530.2-443s21c1
Sequence:GTACCGGGAATGATCCTGGGTAACAAATCTCGAGATTTGTTACCCAGGATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016530.2-506s21c1
Sequence:GTACCGGAGAAGCTAGCAATTGACTATGCTCGAGCATAGTCAATTGCTAGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-1188s21c1
Sequence:GTACCGGTTACTGCCTTGGTAGCATTTACTCGAGTAAATGCTACCAAGGCAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-975s21c1
Sequence:GTACCGGACCTGTTGCAGAAGCGGTTATCTCGAGATAACCGCTTCTGCAACAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-1076s21c1
Sequence:GTACCGGGTCGTGAAGTTCTAGACAAATCTCGAGATTTGTCTAGAACTTCACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016530
VALIDATED
RAB8B MISSION shRNA Lentiviral Transduction Particles
RAB8B, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016530.1-238s1c1
Sequence:CCGGGATAGAACTAGATGGAAAGAACTCGAGTTCTTTCCATCTAGTTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016530.1-673s1c1
Sequence:CCGGCCGATCAAAGAAGACCAGTTTCTCGAGAAACTGGTCTTCTTTGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-445s1c1
Sequence:CCGGCCTGGGTAACAAATGTGATATCTCGAGATATCACATTTGTTACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-505s1c1
Sequence:CCGGGCTAGCAATTGACTATGGGATCTCGAGATCCCATAGTCAATTGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016530.1-433s1c1
Sequence:CCGGCGAAAGAATGATCCTGGGTAACTCGAGTTACCCAGGATCATTCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016530.2-443s21c1
Sequence:GTACCGGGAATGATCCTGGGTAACAAATCTCGAGATTTGTTACCCAGGATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016530.2-506s21c1
Sequence:GTACCGGAGAAGCTAGCAATTGACTATGCTCGAGCATAGTCAATTGCTAGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-1188s21c1
Sequence:GTACCGGTTACTGCCTTGGTAGCATTTACTCGAGTAAATGCTACCAAGGCAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-975s21c1
Sequence:GTACCGGACCTGTTGCAGAAGCGGTTATCTCGAGATAACCGCTTCTGCAACAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016530.2-1076s21c1
Sequence:GTACCGGGTCGTGAAGTTCTAGACAAATCTCGAGATTTGTCTAGAACTTCACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173413
VALIDATED
RAB8B MISSION shRNA Bacterial Glycerol Stock
RAB8B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173413.2-4306s21c1
Sequence:CCGGGCCAAGAACTAACAGAACTTTCTCGAGAAAGTTCTGTTAGTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-253s1c1
Sequence:CCGGCAGGAAAGATTCCGAACAATTCTCGAGAATTGTTCGGAATCTTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-4306s1c1
Sequence:CCGGGCCAAGAACTAACAGAACTTTCTCGAGAAAGTTCTGTTAGTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-264s1c1
Sequence:CCGGCCGAACAATTACGACAGCATACTCGAGTATGCTGTCGTAATTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-417s1c1
Sequence:CCGGCAAATGTGATATGAACGACAACTCGAGTTGTCGTTCATATCACATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173413.2-636s1c1
Sequence:CCGGCCGGTCTAAGAAGACCAGTTTCTCGAGAAACTGGTCTTCTTAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-625s21c1
Sequence:GTACCGGATAACAGAGAGCCGGTCTAAGCTCGAGCTTAGACCGGCTCTCTGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173413.2-199s21c1
Sequence:GTACCGGACGATAGAACTCGACGGAAAGCTCGAGCTTTCCGTCGAGTTCTATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173413.2-417s21c1
Sequence:CCGGCAAATGTGATATGAACGACAACTCGAGTTGTCGTTCATATCACATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-505s21c1
Sequence:CCGGAGTGCAAAGTCGAGTACAAATCTCGAGATTTGTACTCGACTTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-464s21c1
Sequence:CCGGAGAAGTTAGCAATTGACTATGCTCGAGCATAGTCAATTGCTAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-541s21c1
Sequence:CCGGTTTACACTTGCACGGGATATACTCGAGTATATCCCGTGCAAGTGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173413
VALIDATED
RAB8B MISSION shRNA shRNA Plasmid DNA
RAB8B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173413.2-4306s21c1
Sequence:CCGGGCCAAGAACTAACAGAACTTTCTCGAGAAAGTTCTGTTAGTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-253s1c1
Sequence:CCGGCAGGAAAGATTCCGAACAATTCTCGAGAATTGTTCGGAATCTTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-4306s1c1
Sequence:CCGGGCCAAGAACTAACAGAACTTTCTCGAGAAAGTTCTGTTAGTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-264s1c1
Sequence:CCGGCCGAACAATTACGACAGCATACTCGAGTATGCTGTCGTAATTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-417s1c1
Sequence:CCGGCAAATGTGATATGAACGACAACTCGAGTTGTCGTTCATATCACATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173413.2-636s1c1
Sequence:CCGGCCGGTCTAAGAAGACCAGTTTCTCGAGAAACTGGTCTTCTTAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-625s21c1
Sequence:GTACCGGATAACAGAGAGCCGGTCTAAGCTCGAGCTTAGACCGGCTCTCTGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173413.2-199s21c1
Sequence:GTACCGGACGATAGAACTCGACGGAAAGCTCGAGCTTTCCGTCGAGTTCTATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173413.2-417s21c1
Sequence:CCGGCAAATGTGATATGAACGACAACTCGAGTTGTCGTTCATATCACATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-505s21c1
Sequence:CCGGAGTGCAAAGTCGAGTACAAATCTCGAGATTTGTACTCGACTTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-464s21c1
Sequence:CCGGAGAAGTTAGCAATTGACTATGCTCGAGCATAGTCAATTGCTAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-541s21c1
Sequence:CCGGTTTACACTTGCACGGGATATACTCGAGTATATCCCGTGCAAGTGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173413
VALIDATED
RAB8B MISSION shRNA Lentiviral Transduction Particles
RAB8B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173413.2-4306s21c1
Sequence:CCGGGCCAAGAACTAACAGAACTTTCTCGAGAAAGTTCTGTTAGTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-253s1c1
Sequence:CCGGCAGGAAAGATTCCGAACAATTCTCGAGAATTGTTCGGAATCTTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-4306s1c1
Sequence:CCGGGCCAAGAACTAACAGAACTTTCTCGAGAAAGTTCTGTTAGTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-264s1c1
Sequence:CCGGCCGAACAATTACGACAGCATACTCGAGTATGCTGTCGTAATTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173413.2-417s1c1
Sequence:CCGGCAAATGTGATATGAACGACAACTCGAGTTGTCGTTCATATCACATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173413.2-636s1c1
Sequence:CCGGCCGGTCTAAGAAGACCAGTTTCTCGAGAAACTGGTCTTCTTAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-625s21c1
Sequence:GTACCGGATAACAGAGAGCCGGTCTAAGCTCGAGCTTAGACCGGCTCTCTGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173413.2-199s21c1
Sequence:GTACCGGACGATAGAACTCGACGGAAAGCTCGAGCTTTCCGTCGAGTTCTATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173413.2-417s21c1
Sequence:CCGGCAAATGTGATATGAACGACAACTCGAGTTGTCGTTCATATCACATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-505s21c1
Sequence:CCGGAGTGCAAAGTCGAGTACAAATCTCGAGATTTGTACTCGACTTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-464s21c1
Sequence:CCGGAGAAGTTAGCAATTGACTATGCTCGAGCATAGTCAATTGCTAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173413.2-541s21c1
Sequence:CCGGTTTACACTTGCACGGGATATACTCGAGTATATCCCGTGCAAGTGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)