EMAIL THIS PAGE TO A FRIEND

RAB9B

RAB9B, member RAS oncogene family

54 Gene Product Result for
Synonyms: RAB9L Rab-9L
UniProtKB ID: Q9NP90, B2R8M0, Q52LX2
Gene ID:
Human(51209) Summary: This gene encodes a member of a subfamily of RAS small guanosine triphosphate (GTP)-binding proteins that regulate membrane trafficking. The encoded protein may be involved in endosome-to-Golgi transport. [provided by RefSeq, Jan 2010]
Mouse(319642) RAB9B, member RAS oncogene family
Rat(367915) RAB9B, member RAS oncogene family
Zebrafish(100003363) RAB9B, member RAS oncogene family
domestic cat(101098851) RAB9B, member RAS oncogene family
dog(481003) RAB9B, member RAS oncogene family
chicken(422187) RAB9B, member RAS oncogene family
domestic guinea pig(100721710) RAB9B, member RAS oncogene family
naked mole-rat(101698893) RAB9B, member RAS oncogene family
cow(511866) RAB9B, member RAS oncogene family
sheep(101121494) RAB9B, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016370 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016370 Rosetta Predictions human pricing
NM_001109018 Rosetta Predictions rat pricing
NM_176971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349357 predicted 649
2 SASI_Hs01_00031200 predicted 740
3 SASI_Hs01_00031201 predicted 824
4 SASI_Hs01_00031202 predicted 693
5 SASI_Hs01_00031203 predicted 827
6 SASI_Hs01_00031204 predicted 425
7 SASI_Hs01_00031206 predicted 528
8 SASI_Hs01_00031207 predicted 521
9 SASI_Hs01_00031208 predicted 564
10 SASI_Hs02_00349358 predicted 426
11 SASI_Hs01_00031199 predicted 719
12 SASI_Hs01_00031205 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244364 predicted 546
2 SASI_Rn02_00244365 predicted 422
3 SASI_Rn02_00244366 predicted 722
4 SASI_Rn02_00244367 predicted 701
5 SASI_Rn02_00244368 predicted 680
6 SASI_Rn02_00244369 predicted 547
7 SASI_Rn02_00244370 predicted 629
8 SASI_Rn02_00244371 predicted 470
9 SASI_Rn02_00244372 predicted 323
10 SASI_Rn02_00244373 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169833 predicted 535
2 SASI_Mm01_00169834 predicted 689
3 SASI_Mm02_00346883 predicted 543
4 SASI_Mm02_00346884 predicted 638
5 SASI_Mm01_00169835 predicted 1344
6 SASI_Mm01_00169836 predicted 800
7 SASI_Mm01_00169837 predicted 266
8 SASI_Mm01_00169838 predicted 872
9 SASI_Mm02_00346885 predicted 571
10 SASI_Mm01_00169839 predicted 883
11 SASI_Mm01_00169840 predicted 781
12 SASI_Mm01_00169841 predicted 698
13 SASI_Mm01_00169842 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176971
RAB9B MISSION shRNA Bacterial Glycerol Stock
RAB9B, member RAS oncogene family
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-323s21c1
Sequence:GTACCGGAGCTCACTTATGAACCGTTATCTCGAGATAACGGTTCATAAGTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-578s21c1
Sequence:GTACCGGATCTACTATGCAGATGTAAAGCTCGAGCTTTACATCTGCATAGTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-627s21c1
Sequence:GTACCGGTGGGTAACAAGGTAGACAAAGCTCGAGCTTTGTCTACCTTGTTACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176971.1-1403s1c1
Sequence:CCGGGCCAAGTAGTTTATGTCATTTCTCGAGAAATGACATAAACTACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-338s1c1
Sequence:CCGGCCGTTATGTAACCAACAAGTTCTCGAGAACTTGTTGGTTACATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-786s1c1
Sequence:CCGGGTAGAGGAACAGCTGGAACATCTCGAGATGTTCCAGCTGTTCCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-473s1c1
Sequence:CCGGGAGCCTTAGAACACCATTCTACTCGAGTAGAATGGTGTTCTAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-588s1c1
Sequence:CCGGGCAGATGTAAAGGACCCAGATCTCGAGATCTGGGTCCTTTACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176971
RAB9B MISSION shRNA shRNA Plasmid DNA
RAB9B, member RAS oncogene family
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-323s21c1
Sequence:GTACCGGAGCTCACTTATGAACCGTTATCTCGAGATAACGGTTCATAAGTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-578s21c1
Sequence:GTACCGGATCTACTATGCAGATGTAAAGCTCGAGCTTTACATCTGCATAGTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-627s21c1
Sequence:GTACCGGTGGGTAACAAGGTAGACAAAGCTCGAGCTTTGTCTACCTTGTTACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176971.1-1403s1c1
Sequence:CCGGGCCAAGTAGTTTATGTCATTTCTCGAGAAATGACATAAACTACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-338s1c1
Sequence:CCGGCCGTTATGTAACCAACAAGTTCTCGAGAACTTGTTGGTTACATAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-786s1c1
Sequence:CCGGGTAGAGGAACAGCTGGAACATCTCGAGATGTTCCAGCTGTTCCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-473s1c1
Sequence:CCGGGAGCCTTAGAACACCATTCTACTCGAGTAGAATGGTGTTCTAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-588s1c1
Sequence:CCGGGCAGATGTAAAGGACCCAGATCTCGAGATCTGGGTCCTTTACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176971
RAB9B MISSION shRNA Lentiviral Transduction Particles
RAB9B, member RAS oncogene family
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-323s21c1
Sequence:GTACCGGAGCTCACTTATGAACCGTTATCTCGAGATAACGGTTCATAAGTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-578s21c1
Sequence:GTACCGGATCTACTATGCAGATGTAAAGCTCGAGCTTTACATCTGCATAGTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176971.2-627s21c1
Sequence:GTACCGGTGGGTAACAAGGTAGACAAAGCTCGAGCTTTGTCTACCTTGTTACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176971.1-1403s1c1
Sequence:CCGGGCCAAGTAGTTTATGTCATTTCTCGAGAAATGACATAAACTACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-338s1c1
Sequence:CCGGCCGTTATGTAACCAACAAGTTCTCGAGAACTTGTTGGTTACATAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-786s1c1
Sequence:CCGGGTAGAGGAACAGCTGGAACATCTCGAGATGTTCCAGCTGTTCCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-473s1c1
Sequence:CCGGGAGCCTTAGAACACCATTCTACTCGAGTAGAATGGTGTTCTAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176971.1-588s1c1
Sequence:CCGGGCAGATGTAAAGGACCCAGATCTCGAGATCTGGGTCCTTTACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016370
RAB9B MISSION shRNA Bacterial Glycerol Stock
RAB9B, member RAS oncogene family
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-584s21c1
Sequence:CCGGACTGGCAGAAAGAATTTATTTCTCGAGAAATAAATTCTTTCTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-745s21c1
Sequence:CCGGAGTGCCAAAGATGATACTAATCTCGAGATTAGTATCATCTTTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-684s21c1
Sequence:CCGGGACTACTGAGGAGGCACAAACCTCGAGGTTTGTGCCTCCTCAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-557s21c1
Sequence:CCGGATCGGCAGAGCTTCGAGAATCCTCGAGGATTCTCGAAGCTCTGCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-649s1c1
Sequence:CCGGCTGGGTAACAAGGTAGACAAACTCGAGTTTGTCTACCTTGTTACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-361s1c1
Sequence:CCGGCGTTACGTAACCAACAAATTTCTCGAGAAATTTGTTGGTTACGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-444s1c1
Sequence:CCGGACGCTTTGTAACCCTCCAGATCTCGAGATCTGGAGGGTTACAAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-849s1c1
Sequence:CCGGTGACTTGAACAGTGGCTCCAACTCGAGTTGGAGCCACTGTTCAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-409s1c1
Sequence:CCGGGTAGAGTTCTTAAATCGAGATCTCGAGATCTCGATTTAAGAACTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-359s21c1
Sequence:CCGGACCGTTACGTAACCAACAAATCTCGAGATTTGTTGGTTACGTAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016370
RAB9B MISSION shRNA shRNA Plasmid DNA
RAB9B, member RAS oncogene family
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-584s21c1
Sequence:CCGGACTGGCAGAAAGAATTTATTTCTCGAGAAATAAATTCTTTCTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-745s21c1
Sequence:CCGGAGTGCCAAAGATGATACTAATCTCGAGATTAGTATCATCTTTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-684s21c1
Sequence:CCGGGACTACTGAGGAGGCACAAACCTCGAGGTTTGTGCCTCCTCAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-557s21c1
Sequence:CCGGATCGGCAGAGCTTCGAGAATCCTCGAGGATTCTCGAAGCTCTGCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-649s1c1
Sequence:CCGGCTGGGTAACAAGGTAGACAAACTCGAGTTTGTCTACCTTGTTACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-361s1c1
Sequence:CCGGCGTTACGTAACCAACAAATTTCTCGAGAAATTTGTTGGTTACGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-444s1c1
Sequence:CCGGACGCTTTGTAACCCTCCAGATCTCGAGATCTGGAGGGTTACAAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-849s1c1
Sequence:CCGGTGACTTGAACAGTGGCTCCAACTCGAGTTGGAGCCACTGTTCAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-409s1c1
Sequence:CCGGGTAGAGTTCTTAAATCGAGATCTCGAGATCTCGATTTAAGAACTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-359s21c1
Sequence:CCGGACCGTTACGTAACCAACAAATCTCGAGATTTGTTGGTTACGTAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016370
RAB9B MISSION shRNA Lentiviral Transduction Particles
RAB9B, member RAS oncogene family
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-584s21c1
Sequence:CCGGACTGGCAGAAAGAATTTATTTCTCGAGAAATAAATTCTTTCTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-745s21c1
Sequence:CCGGAGTGCCAAAGATGATACTAATCTCGAGATTAGTATCATCTTTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-684s21c1
Sequence:CCGGGACTACTGAGGAGGCACAAACCTCGAGGTTTGTGCCTCCTCAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-557s21c1
Sequence:CCGGATCGGCAGAGCTTCGAGAATCCTCGAGGATTCTCGAAGCTCTGCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-649s1c1
Sequence:CCGGCTGGGTAACAAGGTAGACAAACTCGAGTTTGTCTACCTTGTTACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-361s1c1
Sequence:CCGGCGTTACGTAACCAACAAATTTCTCGAGAAATTTGTTGGTTACGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-444s1c1
Sequence:CCGGACGCTTTGTAACCCTCCAGATCTCGAGATCTGGAGGGTTACAAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-849s1c1
Sequence:CCGGTGACTTGAACAGTGGCTCCAACTCGAGTTGGAGCCACTGTTCAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016370.1-409s1c1
Sequence:CCGGGTAGAGTTCTTAAATCGAGATCTCGAGATCTCGATTTAAGAACTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016370.1-359s21c1
Sequence:CCGGACCGTTACGTAACCAACAAATCTCGAGATTTGTTGGTTACGTAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)