EMAIL THIS PAGE TO A FRIEND

RABAC1

Rab acceptor 1 (prenylated)

59 Gene Product Result for
Synonyms: PRA1 PRAF1 YIP3
UniProtKB ID: Q9UI14, Q7Z4Y2, Q9Y3R1
Gene ID:
Mouse(14470) Rab acceptor 1 (prenylated)
Rat(83583) Rab acceptor 1 (prenylated)
Zebrafish(407650) Rab acceptor 1 (prenylated)
domestic cat(101083382) Rab acceptor 1 (prenylated)
dog(403535) Rab acceptor 1 (prenylated)
cow(512653) Rab acceptor 1 (prenylated)
sheep(100302072) Rab acceptor 1 (prenylated)
naked mole-rat(101721511) Rab acceptor 1 (prenylated)
domestic guinea pig(100724262) Rab acceptor 1 (prenylated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006423 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006423 Rosetta Predictions human pricing
NM_031774 Rosetta Predictions rat pricing
NM_010261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199734 predicted 415
2 SASI_Hs01_00199735 predicted 249
3 SASI_Hs01_00199736 predicted 383
4 SASI_Hs01_00199737 predicted 236
5 SASI_Hs01_00199738 predicted 374
6 SASI_Hs01_00199739 predicted 242
7 SASI_Hs01_00199741 predicted 365
8 SASI_Hs01_00199742 predicted 411
9 SASI_Hs01_00199743 predicted 266
10 SASI_Hs02_00341542 predicted 384
11 SASI_Hs01_00199740 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061693 predicted 312
2 SASI_Rn01_00061694 predicted 593
3 SASI_Rn02_00265210 predicted 323
4 SASI_Rn01_00061695 predicted 434
5 SASI_Rn01_00061696 predicted 424
6 SASI_Rn01_00061697 predicted 291
7 SASI_Rn01_00061698 predicted 293
8 SASI_Rn01_00061700 predicted 446
9 SASI_Rn01_00061701 predicted 283
10 SASI_Rn01_00061702 predicted 563
11 SASI_Rn01_00061699 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095070 predicted 372
2 SASI_Mm01_00095071 predicted 489
3 SASI_Mm01_00095072 predicted 482
4 SASI_Mm02_00318165 predicted 479
5 SASI_Mm01_00095074 predicted 352
6 SASI_Mm01_00095075 predicted 374
7 SASI_Mm01_00095076 predicted 391
8 SASI_Mm01_00095077 predicted 335
9 SASI_Mm01_00095078 predicted 509
10 SASI_Mm01_00095079 predicted 344
11 SASI_Mm01_00095073 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010261
VALIDATED
RABAC1 MISSION shRNA Bacterial Glycerol Stock
Rab acceptor 1 (prenylated)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010261.1-640s1c1
Sequence:CCGGGTGTCCTCCAGGACCTGCCGGCTCGAGCCGGCAGGTCCTGGAGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010261.1-285s1c1
Sequence:CCGGCGCAACGTGGAGTATTATCAACTCGAGTTGATAATACTCCACGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-372s21c1
Sequence:CCGGAGCAACTACGTGTTCGTGTTTCTCGAGAAACACGAACACGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010261.1-395s1c1
Sequence:CCGGCGCCTGTTACATTCTCTATCTCTCGAGAGATAGAGAATGTAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010261.1-425s1c1
Sequence:CCGGGCAGTCTAAGCTTGTACTCTTCTCGAGAAGAGTACAAGCTTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010261.1-306s1c1
Sequence:CCGGAGCAACTACGTGTTCGTGTTTCTCGAGAAACACGAACACGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-351s21c1
Sequence:CCGGCGCAACGTGGAGTATTATCAACTCGAGTTGATAATACTCCACGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-461s21c1
Sequence:CCGGCGCCTGTTACATTCTCTATCTCTCGAGAGATAGAGAATGTAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-491s21c1
Sequence:CCGGGCAGTCTAAGCTTGTACTCTTCTCGAGAAGAGTACAAGCTTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010261
VALIDATED
RABAC1 MISSION shRNA shRNA Plasmid DNA
Rab acceptor 1 (prenylated)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010261.1-640s1c1
Sequence:CCGGGTGTCCTCCAGGACCTGCCGGCTCGAGCCGGCAGGTCCTGGAGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010261.1-285s1c1
Sequence:CCGGCGCAACGTGGAGTATTATCAACTCGAGTTGATAATACTCCACGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-372s21c1
Sequence:CCGGAGCAACTACGTGTTCGTGTTTCTCGAGAAACACGAACACGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010261.1-395s1c1
Sequence:CCGGCGCCTGTTACATTCTCTATCTCTCGAGAGATAGAGAATGTAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010261.1-425s1c1
Sequence:CCGGGCAGTCTAAGCTTGTACTCTTCTCGAGAAGAGTACAAGCTTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010261.1-306s1c1
Sequence:CCGGAGCAACTACGTGTTCGTGTTTCTCGAGAAACACGAACACGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-351s21c1
Sequence:CCGGCGCAACGTGGAGTATTATCAACTCGAGTTGATAATACTCCACGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-461s21c1
Sequence:CCGGCGCCTGTTACATTCTCTATCTCTCGAGAGATAGAGAATGTAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-491s21c1
Sequence:CCGGGCAGTCTAAGCTTGTACTCTTCTCGAGAAGAGTACAAGCTTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010261
VALIDATED
RABAC1 MISSION shRNA Lentiviral Transduction Particles
Rab acceptor 1 (prenylated)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010261.1-640s1c1
Sequence:CCGGGTGTCCTCCAGGACCTGCCGGCTCGAGCCGGCAGGTCCTGGAGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010261.1-285s1c1
Sequence:CCGGCGCAACGTGGAGTATTATCAACTCGAGTTGATAATACTCCACGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-372s21c1
Sequence:CCGGAGCAACTACGTGTTCGTGTTTCTCGAGAAACACGAACACGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010261.1-395s1c1
Sequence:CCGGCGCCTGTTACATTCTCTATCTCTCGAGAGATAGAGAATGTAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010261.1-425s1c1
Sequence:CCGGGCAGTCTAAGCTTGTACTCTTCTCGAGAAGAGTACAAGCTTAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010261.1-306s1c1
Sequence:CCGGAGCAACTACGTGTTCGTGTTTCTCGAGAAACACGAACACGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-351s21c1
Sequence:CCGGCGCAACGTGGAGTATTATCAACTCGAGTTGATAATACTCCACGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-461s21c1
Sequence:CCGGCGCCTGTTACATTCTCTATCTCTCGAGAGATAGAGAATGTAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010261.2-491s21c1
Sequence:CCGGGCAGTCTAAGCTTGTACTCTTCTCGAGAAGAGTACAAGCTTAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006423
VALIDATED
RABAC1 MISSION shRNA Bacterial Glycerol Stock
Rab acceptor 1 (prenylated)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-244s21c1
Sequence:CCGGGAGTACTACCAGAGCAACTATCTCGAGATAGTTGCTCTGGTAGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-377s21c1
Sequence:CCGGAGTCCAAGCTTGTGCTCTTTGCTCGAGCAAAGAGCACAAGCTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-255s21c1
Sequence:CCGGGAGCAACTATGTGTTCGTGTTCTCGAGAACACGAACACATAGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-255s1c1
Sequence:CCGGGAGCAACTATGTGTTCGTGTTCTCGAGAACACGAACACATAGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-244s1c1
Sequence:CCGGGAGTACTACCAGAGCAACTATCTCGAGATAGTTGCTCTGGTAGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-350s1c1
Sequence:CCGGGTTACATTCTCTATCTGCGCACTCGAGTGCGCAGATAGAGAATGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-354s1c1
Sequence:CCGGCATTCTCTATCTGCGCACCTTCTCGAGAAGGTGCGCAGATAGAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-407s21c1
Sequence:CCGGTGAGCCCAGAGCATCAGTATGCTCGAGCATACTGATGCTCTGGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-350s21c1
Sequence:CCGGGTTACATTCTCTATCTGCGCACTCGAGTGCGCAGATAGAGAATGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006423
VALIDATED
RABAC1 MISSION shRNA shRNA Plasmid DNA
Rab acceptor 1 (prenylated)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-244s21c1
Sequence:CCGGGAGTACTACCAGAGCAACTATCTCGAGATAGTTGCTCTGGTAGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-377s21c1
Sequence:CCGGAGTCCAAGCTTGTGCTCTTTGCTCGAGCAAAGAGCACAAGCTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-255s21c1
Sequence:CCGGGAGCAACTATGTGTTCGTGTTCTCGAGAACACGAACACATAGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-255s1c1
Sequence:CCGGGAGCAACTATGTGTTCGTGTTCTCGAGAACACGAACACATAGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-244s1c1
Sequence:CCGGGAGTACTACCAGAGCAACTATCTCGAGATAGTTGCTCTGGTAGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-350s1c1
Sequence:CCGGGTTACATTCTCTATCTGCGCACTCGAGTGCGCAGATAGAGAATGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-354s1c1
Sequence:CCGGCATTCTCTATCTGCGCACCTTCTCGAGAAGGTGCGCAGATAGAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-407s21c1
Sequence:CCGGTGAGCCCAGAGCATCAGTATGCTCGAGCATACTGATGCTCTGGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-350s21c1
Sequence:CCGGGTTACATTCTCTATCTGCGCACTCGAGTGCGCAGATAGAGAATGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006423
VALIDATED
RABAC1 MISSION shRNA Lentiviral Transduction Particles
Rab acceptor 1 (prenylated)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-244s21c1
Sequence:CCGGGAGTACTACCAGAGCAACTATCTCGAGATAGTTGCTCTGGTAGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-377s21c1
Sequence:CCGGAGTCCAAGCTTGTGCTCTTTGCTCGAGCAAAGAGCACAAGCTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-255s21c1
Sequence:CCGGGAGCAACTATGTGTTCGTGTTCTCGAGAACACGAACACATAGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-255s1c1
Sequence:CCGGGAGCAACTATGTGTTCGTGTTCTCGAGAACACGAACACATAGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-244s1c1
Sequence:CCGGGAGTACTACCAGAGCAACTATCTCGAGATAGTTGCTCTGGTAGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-350s1c1
Sequence:CCGGGTTACATTCTCTATCTGCGCACTCGAGTGCGCAGATAGAGAATGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006423.1-354s1c1
Sequence:CCGGCATTCTCTATCTGCGCACCTTCTCGAGAAGGTGCGCAGATAGAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-407s21c1
Sequence:CCGGTGAGCCCAGAGCATCAGTATGCTCGAGCATACTGATGCTCTGGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006423.1-350s21c1
Sequence:CCGGGTTACATTCTCTATCTGCGCACTCGAGTGCGCAGATAGAGAATGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)