EMAIL THIS PAGE TO A FRIEND

RABEP2

rabaptin, RAB GTPase binding effector protein 2

50 Gene Product Result for
Synonyms: FRA
UniProtKB ID: Q9H5N1
Gene ID:
Mouse(70314) rabaptin, RAB GTPase binding effector protein 2
Rat(80754) rabaptin, RAB GTPase binding effector protein 2
Zebrafish(791143) rabaptin, RAB GTPase binding effector protein 2
domestic cat(101091919) rabaptin, RAB GTPase binding effector protein 2
dog(489952) rabaptin, RAB GTPase binding effector protein 2
cow(511736) rabaptin, RAB GTPase binding effector protein 2
sheep(101121484) rabaptin, RAB GTPase binding effector protein 2
domestic guinea pig(100725957) rabaptin, RAB GTPase binding effector protein 2
naked mole-rat(101716665) rabaptin, RAB GTPase binding effector protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024816 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081501 MISSION® esiRNA esiRNA human RABEP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024816 Rosetta Predictions human pricing
NM_030585 Rosetta Predictions rat pricing
NM_030566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131859 predicted 888
2 SASI_Hs01_00131860 predicted 1541
3 SASI_Hs01_00131861 predicted 1147
4 SASI_Hs01_00131862 predicted 509
5 SASI_Hs01_00131863 predicted 1154
6 SASI_Hs01_00131865 predicted 1716
7 SASI_Hs01_00131866 predicted 1410
8 SASI_Hs02_00357377 predicted 503
9 SASI_Hs02_00357378 predicted 1679
10 SASI_Hs01_00131868 predicted 348
11 SASI_Hs01_00131864 predicted 1614
12 SASI_Hs01_00131867 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065250 predicted 1644
2 SASI_Rn01_00065251 predicted 470
3 SASI_Rn01_00065252 predicted 1690
4 SASI_Rn01_00065253 predicted 1654
5 SASI_Rn02_00264028 predicted 1567
6 SASI_Rn01_00065254 predicted 412
7 SASI_Rn01_00065255 predicted 967
8 SASI_Rn01_00065256 predicted 1610
9 SASI_Rn01_00065257 predicted 594
10 SASI_Rn01_00065258 predicted 1539
11 SASI_Rn01_00065259 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184661 predicted 750
2 SASI_Mm01_00184662 predicted 1878
3 SASI_Mm02_00336780 predicted 416
4 SASI_Mm01_00184663 predicted 1999
5 SASI_Mm02_00336781 predicted 1749
6 SASI_Mm01_00184664 predicted 1167
7 SASI_Mm01_00184665 predicted 2148
8 SASI_Mm01_00184666 predicted 777
9 SASI_Mm02_00336782 predicted 2314
10 SASI_Mm01_00184667 predicted 1270
11 SASI_Mm01_00184668 predicted 1165
12 SASI_Mm01_00184669 predicted 1098
13 SASI_Mm01_00184670 predicted 1569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024816
RABEP2 MISSION shRNA Bacterial Glycerol Stock
rabaptin, RAB GTPase binding effector protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-1170s1c1
Sequence:CCGGCCATGAGGTAAAGCGGTTGAACTCGAGTTCAACCGCTTTACCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-198s1c1
Sequence:CCGGCCTGGCAGAAATGGAAACCATCTCGAGATGGTTTCCATTTCTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-1557s1c1
Sequence:CCGGCCTCTCAGAACAGAGGGCCAACTCGAGTTGGCCCTCTGTTCTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-509s1c1
Sequence:CCGGAGATCGTACTGCCCATGGAAACTCGAGTTTCCATGGGCAGTACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-715s1c1
Sequence:CCGGGCCTTCGCTCACAACTGCGATCTCGAGATCGCAGTTGTGAGCGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024816.2-1622s21c1
Sequence:CCGGAGAGGGATTTCGTGCGACTGTCTCGAGACAGTCGCACGAAATCCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024816.2-1009s21c1
Sequence:CCGGAGACGGAGCAATGAGGACTGTCTCGAGACAGTCCTCATTGCTCCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024816
RABEP2 MISSION shRNA shRNA Plasmid DNA
rabaptin, RAB GTPase binding effector protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-1170s1c1
Sequence:CCGGCCATGAGGTAAAGCGGTTGAACTCGAGTTCAACCGCTTTACCTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-198s1c1
Sequence:CCGGCCTGGCAGAAATGGAAACCATCTCGAGATGGTTTCCATTTCTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-1557s1c1
Sequence:CCGGCCTCTCAGAACAGAGGGCCAACTCGAGTTGGCCCTCTGTTCTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-509s1c1
Sequence:CCGGAGATCGTACTGCCCATGGAAACTCGAGTTTCCATGGGCAGTACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-715s1c1
Sequence:CCGGGCCTTCGCTCACAACTGCGATCTCGAGATCGCAGTTGTGAGCGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024816.2-1622s21c1
Sequence:CCGGAGAGGGATTTCGTGCGACTGTCTCGAGACAGTCGCACGAAATCCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024816.2-1009s21c1
Sequence:CCGGAGACGGAGCAATGAGGACTGTCTCGAGACAGTCCTCATTGCTCCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024816
RABEP2 MISSION shRNA Lentiviral Transduction Particles
rabaptin, RAB GTPase binding effector protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-1170s1c1
Sequence:CCGGCCATGAGGTAAAGCGGTTGAACTCGAGTTCAACCGCTTTACCTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-198s1c1
Sequence:CCGGCCTGGCAGAAATGGAAACCATCTCGAGATGGTTTCCATTTCTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-1557s1c1
Sequence:CCGGCCTCTCAGAACAGAGGGCCAACTCGAGTTGGCCCTCTGTTCTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-509s1c1
Sequence:CCGGAGATCGTACTGCCCATGGAAACTCGAGTTTCCATGGGCAGTACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024816.1-715s1c1
Sequence:CCGGGCCTTCGCTCACAACTGCGATCTCGAGATCGCAGTTGTGAGCGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024816.2-1622s21c1
Sequence:CCGGAGAGGGATTTCGTGCGACTGTCTCGAGACAGTCGCACGAAATCCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024816.2-1009s21c1
Sequence:CCGGAGACGGAGCAATGAGGACTGTCTCGAGACAGTCCTCATTGCTCCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030566
VALIDATED
RABEP2 MISSION shRNA Bacterial Glycerol Stock
rabaptin, RAB GTPase binding effector protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030566.2-1637s21c1
Sequence:CCGGTGAGCGCCTGCGCATTGAAATCTCGAGATTTCAATGCGCAGGCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-1262s21c1
Sequence:CCGGTGAGCTGCAGGAAGGACTAAGCTCGAGCTTAGTCCTTCCTGCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030566.2-2001s21c1
Sequence:CCGGAGGGACATCAGGGACATTAAACTCGAGTTTAATGTCCCTGATGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-1434s21c1
Sequence:CCGGTGCCTGAGCCAAGAGGTTAAACTCGAGTTTAACCTCTTGGCTCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-2069s21c1
Sequence:CCGGCCTTTCTCTACAAGAACTATGCTCGAGCATAGTTCTTGTAGAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030566
VALIDATED
RABEP2 MISSION shRNA shRNA Plasmid DNA
rabaptin, RAB GTPase binding effector protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030566.2-1637s21c1
Sequence:CCGGTGAGCGCCTGCGCATTGAAATCTCGAGATTTCAATGCGCAGGCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-1262s21c1
Sequence:CCGGTGAGCTGCAGGAAGGACTAAGCTCGAGCTTAGTCCTTCCTGCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030566.2-2001s21c1
Sequence:CCGGAGGGACATCAGGGACATTAAACTCGAGTTTAATGTCCCTGATGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-1434s21c1
Sequence:CCGGTGCCTGAGCCAAGAGGTTAAACTCGAGTTTAACCTCTTGGCTCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-2069s21c1
Sequence:CCGGCCTTTCTCTACAAGAACTATGCTCGAGCATAGTTCTTGTAGAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030566
VALIDATED
RABEP2 MISSION shRNA Lentiviral Transduction Particles
rabaptin, RAB GTPase binding effector protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030566.2-1637s21c1
Sequence:CCGGTGAGCGCCTGCGCATTGAAATCTCGAGATTTCAATGCGCAGGCGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-1262s21c1
Sequence:CCGGTGAGCTGCAGGAAGGACTAAGCTCGAGCTTAGTCCTTCCTGCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030566.2-2001s21c1
Sequence:CCGGAGGGACATCAGGGACATTAAACTCGAGTTTAATGTCCCTGATGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-1434s21c1
Sequence:CCGGTGCCTGAGCCAAGAGGTTAAACTCGAGTTTAACCTCTTGGCTCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030566.2-2069s21c1
Sequence:CCGGCCTTTCTCTACAAGAACTATGCTCGAGCATAGTTCTTGTAGAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)