EMAIL THIS PAGE TO A FRIEND

RABEPK

Rab9 effector protein with kelch motifs

66 Gene Product Result for
Synonyms: RAB9P40 bA65N13.1 p40
Gene ID:
Mouse(227746) Rab9 effector protein with kelch motifs
Rat(296649) Rab9 effector protein with kelch motifs
naked mole-rat(101713695) Rab9 effector protein with kelch motifs
Domestic Rabbit(100340956) Rab9 effector protein with kelch motifs
domestic guinea pig(100731384) Rab9 effector protein with kelch motifs
cow(533613) Rab9 effector protein with kelch motifs
sheep(101106502) Rab9 effector protein with kelch motifs
chicken(772357) Rab9 effector protein with kelch motifs
domestic cat(101083217) Rab9 effector protein with kelch motifs
dog(609581) Rab9 effector protein with kelch motifs
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090091 MISSION® esiRNA esiRNA human RABEPK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005833 Rosetta Predictions human pricing
NM_001024871 Rosetta Predictions rat pricing
NM_145522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071313 predicted 1118
2 SASI_Hs01_00071315 predicted 970
3 SASI_Hs01_00071316 predicted 450
4 SASI_Hs01_00071317 predicted 964
5 SASI_Hs01_00071318 predicted 578
6 SASI_Hs01_00071319 predicted 468
7 SASI_Hs01_00071320 predicted 900
8 SASI_Hs01_00071321 predicted 1011
9 SASI_Hs01_00071322 predicted 393
10 SASI_Hs02_00340364 predicted 458
11 SASI_Hs01_00071314 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202750 predicted 1068
2 SASI_Rn02_00202751 predicted 1219
3 SASI_Rn01_00034335 predicted 601
4 SASI_Rn01_00034336 predicted 767
5 SASI_Rn01_00034337 predicted 627
6 SASI_Rn01_00034338 predicted 620
7 SASI_Rn01_00034339 predicted 603
8 SASI_Rn01_00034340 predicted 862
9 SASI_Rn01_00034341 predicted 926
10 SASI_Rn02_00202752 predicted 864
11 SASI_Rn01_00034332 predicted 1226
12 SASI_Rn01_00034333 predicted 1358
13 SASI_Rn01_00034334 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106908 predicted 957
2 SASI_Mm01_00106909 predicted 1169
3 SASI_Mm01_00106910 predicted 479
4 SASI_Mm01_00106912 predicted 957
5 SASI_Mm01_00106913 predicted 1070
6 SASI_Mm01_00106914 predicted 804
7 SASI_Mm01_00106915 predicted 886
8 SASI_Mm02_00340994 predicted 849
9 SASI_Mm02_00340995 predicted 463
10 SASI_Mm02_00340996 predicted 581
11 SASI_Mm01_00106906 predicted 1145
12 SASI_Mm01_00106907 predicted 1143
13 SASI_Mm01_00106911 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005833
VALIDATED
RABEPK MISSION shRNA Bacterial Glycerol Stock
Rab9 effector protein with kelch motifs
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005833.2-1274s21c1
Sequence:CCGGTATTACCTGTCAGTTACTTTCCTCGAGGAAAGTAACTGACAGGTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005833.2-1229s1c1
Sequence:CCGGGACGATTGTATTGTGACTGTACTCGAGTACAGTCACAATACAATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005833.2-460s1c1
Sequence:CCGGCAACCAATCAGGAAATCGAAACTCGAGTTTCGATTTCCTGATTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-181s1c1
Sequence:CCGGGAAAGCAACATGGTACACCTTCTCGAGAAGGTGTACCATGTTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-1094s1c1
Sequence:CCGGCTGAACCATGAAGCTGAGAAACTCGAGTTTCTCAGCTTCATGGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-459s1c1
Sequence:CCGGCCAACCAATCAGGAAATCGAACTCGAGTTCGATTTCCTGATTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-791s1c1
Sequence:CCGGGATGACCTCCACTGCATTGATCTCGAGATCAATGCAGTGGAGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-394s1c1
Sequence:CCGGCCGGTATGAACATGCTAGCTTCTCGAGAAGCTAGCATGTTCATACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005833.2-579s21c1
Sequence:CCGGCCATTGGAAACCAGCTATATGCTCGAGCATATAGCTGGTTTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005833.2-1229s21c1
Sequence:CCGGGACGATTGTATTGTGACTGTACTCGAGTACAGTCACAATACAATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005833.2-462s21c1
Sequence:CCGGACCAATCAGGAAATCGAAATTCTCGAGAATTTCGATTTCCTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005833.2-432s21c1
Sequence:CCGGCTGACCGTATCTGGGTATTTGCTCGAGCAAATACCCAGATACGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005833.2-1370s1c1
Sequence:CCGGCTTTGGTAGGTGAAGAAACTACTCGAGTAGTTTCTTCACCTACCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005833
VALIDATED
RABEPK MISSION shRNA shRNA Plasmid DNA
Rab9 effector protein with kelch motifs
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005833.2-1274s21c1
Sequence:CCGGTATTACCTGTCAGTTACTTTCCTCGAGGAAAGTAACTGACAGGTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005833.2-1229s1c1
Sequence:CCGGGACGATTGTATTGTGACTGTACTCGAGTACAGTCACAATACAATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005833.2-460s1c1
Sequence:CCGGCAACCAATCAGGAAATCGAAACTCGAGTTTCGATTTCCTGATTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-181s1c1
Sequence:CCGGGAAAGCAACATGGTACACCTTCTCGAGAAGGTGTACCATGTTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-1094s1c1
Sequence:CCGGCTGAACCATGAAGCTGAGAAACTCGAGTTTCTCAGCTTCATGGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-459s1c1
Sequence:CCGGCCAACCAATCAGGAAATCGAACTCGAGTTCGATTTCCTGATTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-791s1c1
Sequence:CCGGGATGACCTCCACTGCATTGATCTCGAGATCAATGCAGTGGAGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-394s1c1
Sequence:CCGGCCGGTATGAACATGCTAGCTTCTCGAGAAGCTAGCATGTTCATACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005833.2-579s21c1
Sequence:CCGGCCATTGGAAACCAGCTATATGCTCGAGCATATAGCTGGTTTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005833.2-1229s21c1
Sequence:CCGGGACGATTGTATTGTGACTGTACTCGAGTACAGTCACAATACAATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005833.2-462s21c1
Sequence:CCGGACCAATCAGGAAATCGAAATTCTCGAGAATTTCGATTTCCTGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005833.2-432s21c1
Sequence:CCGGCTGACCGTATCTGGGTATTTGCTCGAGCAAATACCCAGATACGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005833.2-1370s1c1
Sequence:CCGGCTTTGGTAGGTGAAGAAACTACTCGAGTAGTTTCTTCACCTACCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005833
VALIDATED
RABEPK MISSION shRNA Lentiviral Transduction Particles
Rab9 effector protein with kelch motifs
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005833.2-1274s21c1
Sequence:CCGGTATTACCTGTCAGTTACTTTCCTCGAGGAAAGTAACTGACAGGTAATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005833.2-1229s1c1
Sequence:CCGGGACGATTGTATTGTGACTGTACTCGAGTACAGTCACAATACAATCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005833.2-460s1c1
Sequence:CCGGCAACCAATCAGGAAATCGAAACTCGAGTTTCGATTTCCTGATTGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-181s1c1
Sequence:CCGGGAAAGCAACATGGTACACCTTCTCGAGAAGGTGTACCATGTTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-1094s1c1
Sequence:CCGGCTGAACCATGAAGCTGAGAAACTCGAGTTTCTCAGCTTCATGGTTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-459s1c1
Sequence:CCGGCCAACCAATCAGGAAATCGAACTCGAGTTCGATTTCCTGATTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-791s1c1
Sequence:CCGGGATGACCTCCACTGCATTGATCTCGAGATCAATGCAGTGGAGGTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005833.2-394s1c1
Sequence:CCGGCCGGTATGAACATGCTAGCTTCTCGAGAAGCTAGCATGTTCATACCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005833.2-579s21c1
Sequence:CCGGCCATTGGAAACCAGCTATATGCTCGAGCATATAGCTGGTTTCCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005833.2-1229s21c1
Sequence:CCGGGACGATTGTATTGTGACTGTACTCGAGTACAGTCACAATACAATCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005833.2-462s21c1
Sequence:CCGGACCAATCAGGAAATCGAAATTCTCGAGAATTTCGATTTCCTGATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005833.2-432s21c1
Sequence:CCGGCTGACCGTATCTGGGTATTTGCTCGAGCAAATACCCAGATACGGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005833.2-1370s1c1
Sequence:CCGGCTTTGGTAGGTGAAGAAACTACTCGAGTAGTTTCTTCACCTACCAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145522
VALIDATED
RABEPK MISSION shRNA Bacterial Glycerol Stock
Rab9 effector protein with kelch motifs
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145522.2-882s1c1
Sequence:CCGGGCACTGGACTGTACTTCAGTTCTCGAGAACTGAAGTACAGTCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145522.2-492s1c1
Sequence:CCGGCGGAAACCAACTATACGTCTTCTCGAGAAGACGTATAGTTGGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145522.2-1454s1c1
Sequence:CCGGCCTAGTGCAAATAATTCCATTCTCGAGAATGGAATTATTTGCACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145522.2-963s1c1
Sequence:CCGGGATGTCTACCTCTGAGAATAACTCGAGTTATTCTCAGAGGTAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-491s21c1
Sequence:CCGGCGGAAACCAACTATACGTCTTCTCGAGAAGACGTATAGTTGGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-712s21c1
Sequence:CCGGGCATTGATATAGGTGACATGACTCGAGTCATGTCACCTATATCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-962s21c1
Sequence:CCGGGATGTCTACCTCTGAGAATAACTCGAGTTATTCTCAGAGGTAGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-881s21c1
Sequence:CCGGGCACTGGACTGTACTTCAGTTCTCGAGAACTGAAGTACAGTCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145522.2-713s1c1
Sequence:CCGGGCATTGATATAGGTGACATGACTCGAGTCATGTCACCTATATCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145522
VALIDATED
RABEPK MISSION shRNA shRNA Plasmid DNA
Rab9 effector protein with kelch motifs
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145522.2-882s1c1
Sequence:CCGGGCACTGGACTGTACTTCAGTTCTCGAGAACTGAAGTACAGTCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145522.2-492s1c1
Sequence:CCGGCGGAAACCAACTATACGTCTTCTCGAGAAGACGTATAGTTGGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145522.2-1454s1c1
Sequence:CCGGCCTAGTGCAAATAATTCCATTCTCGAGAATGGAATTATTTGCACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145522.2-963s1c1
Sequence:CCGGGATGTCTACCTCTGAGAATAACTCGAGTTATTCTCAGAGGTAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-491s21c1
Sequence:CCGGCGGAAACCAACTATACGTCTTCTCGAGAAGACGTATAGTTGGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-712s21c1
Sequence:CCGGGCATTGATATAGGTGACATGACTCGAGTCATGTCACCTATATCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-962s21c1
Sequence:CCGGGATGTCTACCTCTGAGAATAACTCGAGTTATTCTCAGAGGTAGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-881s21c1
Sequence:CCGGGCACTGGACTGTACTTCAGTTCTCGAGAACTGAAGTACAGTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145522.2-713s1c1
Sequence:CCGGGCATTGATATAGGTGACATGACTCGAGTCATGTCACCTATATCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145522
VALIDATED
RABEPK MISSION shRNA Lentiviral Transduction Particles
Rab9 effector protein with kelch motifs
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145522.2-882s1c1
Sequence:CCGGGCACTGGACTGTACTTCAGTTCTCGAGAACTGAAGTACAGTCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145522.2-492s1c1
Sequence:CCGGCGGAAACCAACTATACGTCTTCTCGAGAAGACGTATAGTTGGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145522.2-1454s1c1
Sequence:CCGGCCTAGTGCAAATAATTCCATTCTCGAGAATGGAATTATTTGCACTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145522.2-963s1c1
Sequence:CCGGGATGTCTACCTCTGAGAATAACTCGAGTTATTCTCAGAGGTAGACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-491s21c1
Sequence:CCGGCGGAAACCAACTATACGTCTTCTCGAGAAGACGTATAGTTGGTTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-712s21c1
Sequence:CCGGGCATTGATATAGGTGACATGACTCGAGTCATGTCACCTATATCAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-962s21c1
Sequence:CCGGGATGTCTACCTCTGAGAATAACTCGAGTTATTCTCAGAGGTAGACATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145522.3-881s21c1
Sequence:CCGGGCACTGGACTGTACTTCAGTTCTCGAGAACTGAAGTACAGTCCAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145522.2-713s1c1
Sequence:CCGGGCATTGATATAGGTGACATGACTCGAGTCATGTCACCTATATCAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)