EMAIL THIS PAGE TO A FRIEND

RABGAP1L

RAB GTPase activating protein 1-like

159 Gene Product Result for
Synonyms: HHL TBC1D18
Gene ID:
Mouse(29809) RAB GTPase activating protein 1-like
Rat(304914) RAB GTPase activating protein 1-like
naked mole-rat(101720199) RAB GTPase activating protein 1-like
domestic guinea pig(100719248) RAB GTPase activating protein 1-like
cow(540101) RAB GTPase activating protein 1-like
cow(527428) RAB GTPase activating protein 1-like
chicken(424438) RAB GTPase activating protein 1-like
dog(480064) RAB GTPase activating protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014857 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035230 Rosetta Predictions human pricing
NM_014857 Rosetta Predictions human pricing
NM_001107190 Rosetta Predictions rat pricing
NM_001038621 Rosetta Predictions mouse pricing
NM_013862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093664 predicted 291
2 SASI_Hs01_00093665 predicted 312
3 SASI_Hs01_00093666 predicted 281
4 SASI_Hs01_00093667 predicted 270
5 SASI_Hs01_00093668 predicted 292
6 SASI_Hs01_00093669 predicted 292
7 SASI_Hs01_00093670 predicted 279
8 SASI_Hs01_00093671 predicted 278
9 SASI_Hs01_00093672 predicted 322
10 SASI_Hs01_00093673 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036536 predicted 656
2 SASI_Hs01_00036538 predicted 1308
3 SASI_Hs02_00346435 predicted 1221
4 SASI_Hs01_00036539 predicted 1485
5 SASI_Hs01_00036540 predicted 2637
6 SASI_Hs01_00036542 predicted 945
7 SASI_Hs02_00346436 predicted 2100
8 SASI_Hs02_00346437 predicted 439
9 SASI_Hs01_00036543 predicted 1705
10 SASI_Hs01_00036544 predicted 1233
11 SASI_Hs01_00036537 predicted 1665
12 SASI_Hs01_00036541 predicted 283
13 SASI_Hs01_00036545 predicted 2368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226395 predicted 1094
2 SASI_Rn02_00226396 predicted 1278
3 SASI_Rn02_00226397 predicted 1066
4 SASI_Rn02_00226398 predicted 1764
5 SASI_Rn02_00226399 predicted 1562
6 SASI_Rn02_00226400 predicted 806
7 SASI_Rn02_00226401 predicted 621
8 SASI_Rn02_00226402 predicted 1083
9 SASI_Rn02_00226403 predicted 966
10 SASI_Rn02_00226404 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073735 predicted 692
2 SASI_Mm01_00073736 predicted 920
3 SASI_Mm01_00073737 predicted 269
4 SASI_Mm01_00073738 predicted 925
5 SASI_Mm01_00073739 predicted 627
6 SASI_Mm01_00073740 predicted 1305
7 SASI_Mm01_00073741 predicted 321
8 SASI_Mm01_00073742 predicted 1162
9 SASI_Mm01_00073743 predicted 840
10 SASI_Mm01_00073744 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123412 predicted 2176
2 SASI_Mm01_00123413 predicted 677
3 SASI_Mm01_00123414 predicted 642
4 SASI_Mm01_00123415 predicted 1833
5 SASI_Mm01_00123416 predicted 1876
6 SASI_Mm01_00123417 predicted 1287
7 SASI_Mm01_00123418 predicted 1863
8 SASI_Mm01_00123419 predicted 1755
9 SASI_Mm02_00322878 predicted 1305
10 SASI_Mm01_00123420 predicted 1485
11 SASI_Mm01_00123421 predicted 2189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013862
VALIDATED
RABGAP1L MISSION shRNA Bacterial Glycerol Stock
RAB GTPase activating protein 1-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.5-1877s21c1
Sequence:CCGGGGCAGAAGTATGGCAACTATTCTCGAGAATAGTTGCCATACTTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1126s21c1
Sequence:CCGGTGCCTAAGGATAGAGATAAATCTCGAGATTTATCTCTATCCTTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1793s21c1
Sequence:CCGGGTTAGGAAGATGGCACAATAACTCGAGTTATTGTGCCATCTTCCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013862.4-2035s21c1
Sequence:CCGGGCGATGGTCAAGAATCCCTTTCTCGAGAAAGGGATTCTTGACCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1970s21c1
Sequence:CCGGGAGTGTTATTACTCGAGATATCTCGAGATATCTCGAGTAATAACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-1971s1c1
Sequence:CCGGGAGTGTTATTACTCGAGATATCTCGAGATATCTCGAGTAATAACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013862.3-1395s1c1
Sequence:CCGGGCCCAAAGATAAACGGGTGTACTCGAGTACACCCGTTTATCTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-346s1c1
Sequence:CCGGGCCACTTCTATAAAGGATGATCTCGAGATCATCCTTTATAGAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-2036s1c1
Sequence:CCGGGCGATGGTCAAGAATCCCTTTCTCGAGAAAGGGATTCTTGACCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013862
VALIDATED
RABGAP1L MISSION shRNA shRNA Plasmid DNA
RAB GTPase activating protein 1-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.5-1877s21c1
Sequence:CCGGGGCAGAAGTATGGCAACTATTCTCGAGAATAGTTGCCATACTTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1126s21c1
Sequence:CCGGTGCCTAAGGATAGAGATAAATCTCGAGATTTATCTCTATCCTTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1793s21c1
Sequence:CCGGGTTAGGAAGATGGCACAATAACTCGAGTTATTGTGCCATCTTCCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013862.4-2035s21c1
Sequence:CCGGGCGATGGTCAAGAATCCCTTTCTCGAGAAAGGGATTCTTGACCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1970s21c1
Sequence:CCGGGAGTGTTATTACTCGAGATATCTCGAGATATCTCGAGTAATAACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-1971s1c1
Sequence:CCGGGAGTGTTATTACTCGAGATATCTCGAGATATCTCGAGTAATAACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013862.3-1395s1c1
Sequence:CCGGGCCCAAAGATAAACGGGTGTACTCGAGTACACCCGTTTATCTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-346s1c1
Sequence:CCGGGCCACTTCTATAAAGGATGATCTCGAGATCATCCTTTATAGAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-2036s1c1
Sequence:CCGGGCGATGGTCAAGAATCCCTTTCTCGAGAAAGGGATTCTTGACCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013862
VALIDATED
RABGAP1L MISSION shRNA Lentiviral Transduction Particles
RAB GTPase activating protein 1-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.5-1877s21c1
Sequence:CCGGGGCAGAAGTATGGCAACTATTCTCGAGAATAGTTGCCATACTTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1126s21c1
Sequence:CCGGTGCCTAAGGATAGAGATAAATCTCGAGATTTATCTCTATCCTTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1793s21c1
Sequence:CCGGGTTAGGAAGATGGCACAATAACTCGAGTTATTGTGCCATCTTCCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013862.4-2035s21c1
Sequence:CCGGGCGATGGTCAAGAATCCCTTTCTCGAGAAAGGGATTCTTGACCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013862.4-1970s21c1
Sequence:CCGGGAGTGTTATTACTCGAGATATCTCGAGATATCTCGAGTAATAACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-1971s1c1
Sequence:CCGGGAGTGTTATTACTCGAGATATCTCGAGATATCTCGAGTAATAACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013862.3-1395s1c1
Sequence:CCGGGCCCAAAGATAAACGGGTGTACTCGAGTACACCCGTTTATCTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-346s1c1
Sequence:CCGGGCCACTTCTATAAAGGATGATCTCGAGATCATCCTTTATAGAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013862.3-2036s1c1
Sequence:CCGGGCGATGGTCAAGAATCCCTTTCTCGAGAAAGGGATTCTTGACCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014857
VALIDATED
RABGAP1L MISSION shRNA Bacterial Glycerol Stock
RAB GTPase activating protein 1-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014857.3-1933s21c1
Sequence:CCGGCGAGATATTCATCGTACATTTCTCGAGAAATGTACGATGAATATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014857.3-2229s21c1
Sequence:CCGGACCGGACCTGCATAGCCATTTCTCGAGAAATGGCTATGCAGGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014857.3-777s21c1
Sequence:CCGGTCCAATCTATAAGGTGTTATTCTCGAGAATAACACCTTATAGATTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014857.3-1988s21c1
Sequence:CCGGATGGTCAAGAATCGCTCTATACTCGAGTATAGAGCGATTCTTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014857.3-2645s21c1
Sequence:CCGGTAACTCCAGCTGTTGCATTTACTCGAGTAAATGCAACAGCTGGAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014857.2-1926s1c1
Sequence:CCGGCGAGATATTCATCGTACATTTCTCGAGAAATGTACGATGAATATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-1070s1c1
Sequence:CCGGGCCTAAGGATAGAGATAAATTCTCGAGAATTTATCTCTATCCTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-1305s1c1
Sequence:CCGGGCACCAGTATTTCTGGCACTTCTCGAGAAGTGCCAGAAATACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-466s1c1
Sequence:CCGGCCAGCCAAACAAATAAGCCATCTCGAGATGGCTTATTTGTTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-624s1c1
Sequence:CCGGCGTAATGAAGTAGAGGCTTTACTCGAGTAAAGCCTCTACTTCATTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014857
VALIDATED
RABGAP1L MISSION shRNA shRNA Plasmid DNA
RAB GTPase activating protein 1-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014857.3-1933s21c1
Sequence:CCGGCGAGATATTCATCGTACATTTCTCGAGAAATGTACGATGAATATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014857.3-2229s21c1
Sequence:CCGGACCGGACCTGCATAGCCATTTCTCGAGAAATGGCTATGCAGGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014857.3-777s21c1
Sequence:CCGGTCCAATCTATAAGGTGTTATTCTCGAGAATAACACCTTATAGATTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014857.3-1988s21c1
Sequence:CCGGATGGTCAAGAATCGCTCTATACTCGAGTATAGAGCGATTCTTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014857.3-2645s21c1
Sequence:CCGGTAACTCCAGCTGTTGCATTTACTCGAGTAAATGCAACAGCTGGAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014857.2-1926s1c1
Sequence:CCGGCGAGATATTCATCGTACATTTCTCGAGAAATGTACGATGAATATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-1070s1c1
Sequence:CCGGGCCTAAGGATAGAGATAAATTCTCGAGAATTTATCTCTATCCTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-1305s1c1
Sequence:CCGGGCACCAGTATTTCTGGCACTTCTCGAGAAGTGCCAGAAATACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-466s1c1
Sequence:CCGGCCAGCCAAACAAATAAGCCATCTCGAGATGGCTTATTTGTTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-624s1c1
Sequence:CCGGCGTAATGAAGTAGAGGCTTTACTCGAGTAAAGCCTCTACTTCATTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014857
VALIDATED
RABGAP1L MISSION shRNA Lentiviral Transduction Particles
RAB GTPase activating protein 1-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014857.3-1933s21c1
Sequence:CCGGCGAGATATTCATCGTACATTTCTCGAGAAATGTACGATGAATATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014857.3-2229s21c1
Sequence:CCGGACCGGACCTGCATAGCCATTTCTCGAGAAATGGCTATGCAGGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014857.3-777s21c1
Sequence:CCGGTCCAATCTATAAGGTGTTATTCTCGAGAATAACACCTTATAGATTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014857.3-1988s21c1
Sequence:CCGGATGGTCAAGAATCGCTCTATACTCGAGTATAGAGCGATTCTTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014857.3-2645s21c1
Sequence:CCGGTAACTCCAGCTGTTGCATTTACTCGAGTAAATGCAACAGCTGGAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014857.2-1926s1c1
Sequence:CCGGCGAGATATTCATCGTACATTTCTCGAGAAATGTACGATGAATATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-1070s1c1
Sequence:CCGGGCCTAAGGATAGAGATAAATTCTCGAGAATTTATCTCTATCCTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-1305s1c1
Sequence:CCGGGCACCAGTATTTCTGGCACTTCTCGAGAAGTGCCAGAAATACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-466s1c1
Sequence:CCGGCCAGCCAAACAAATAAGCCATCTCGAGATGGCTTATTTGTTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014857.2-624s1c1
Sequence:CCGGCGTAATGAAGTAGAGGCTTTACTCGAGTAAAGCCTCTACTTCATTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)