EMAIL THIS PAGE TO A FRIEND

RABGEF1

RAB guanine nucleotide exchange factor (GEF) 1

148 Gene Product Result for
Synonyms: RABEX5 rabex-5
UniProtKB ID: Q9UJ41, Q3HKR2, Q3HKR3, Q53FG0
Gene ID:
Human(27342) Summary: RABGEF1 forms a complex with rabaptin-5 (RABPT5; MIM 603616) that is required for endocytic membrane fusion, and it serves as a specific guanine nucleotide exchange factor (GEF) for RAB5 (RAB5A; MIM 179512) (Horiuchi et al., 1997 [PubMed 9323142]
Mouse(56715) RAB guanine nucleotide exchange factor (GEF) 1
Rat(360797) RAB guanine nucleotide exchange factor (GEF) 1
Zebrafish(393816) RAB guanine nucleotide exchange factor (GEF) 1
domestic cat(101083989) RAB guanine nucleotide exchange factor (GEF) 1
dog(479706) RAB guanine nucleotide exchange factor (GEF) 1
chicken(417548) RAB guanine nucleotide exchange factor (GEF) 1
cow(282335) RAB guanine nucleotide exchange factor (GEF) 1
sheep(101110292) RAB guanine nucleotide exchange factor (GEF) 1
Goat(100861034) RAB guanine nucleotide exchange factor (GEF) 1
domestic guinea pig(100733670) RAB guanine nucleotide exchange factor (GEF) 1
naked mole-rat(101713290) RAB guanine nucleotide exchange factor (GEF) 1
Domestic Rabbit(100344954) RAB guanine nucleotide exchange factor (GEF) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014504 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012471 MISSION® esiRNA esiRNA targeting human RABGEF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014504 Rosetta Predictions human pricing
NM_001108333 Rosetta Predictions rat pricing
NM_019983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112774 predicted 1683
2 SASI_Hs01_00112775 predicted 1721
3 SASI_Hs01_00112776 predicted 1270
4 SASI_Hs01_00112778 predicted 573
5 SASI_Hs01_00112779 predicted 1538
6 SASI_Hs01_00112780 predicted 610
7 SASI_Hs02_00345763 predicted 392
8 SASI_Hs01_00112781 predicted 1460
9 SASI_Hs01_00112782 predicted 563
10 SASI_Hs01_00112783 predicted 1422
11 SASI_Hs01_00112777 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237629 predicted 289
2 SASI_Rn02_00237630 predicted 867
3 SASI_Rn02_00237631 predicted 1349
4 SASI_Rn02_00237632 predicted 1049
5 SASI_Rn02_00237633 predicted 280
6 SASI_Rn02_00237634 predicted 204
7 SASI_Rn02_00237635 predicted 381
8 SASI_Rn02_00237636 predicted 881
9 SASI_Rn02_00237637 predicted 1568
10 SASI_Rn02_00237638 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048363 predicted 866
2 SASI_Mm02_00325324 predicted 864
3 SASI_Mm01_00048364 predicted 1038
4 SASI_Mm01_00048365 predicted 1506
5 SASI_Mm01_00048366 predicted 1771
6 SASI_Mm01_00048368 predicted 877
7 SASI_Mm01_00048369 predicted 1587
8 SASI_Mm01_00048370 predicted 890
9 SASI_Mm01_00048371 predicted 733
10 SASI_Mm01_00048372 predicted 678
11 SASI_Mm01_00048367 predicted 1281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019983
RABGEF1 MISSION shRNA Bacterial Glycerol Stock
RAB guanine nucleotide exchange factor (GEF) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019983.2-1762s1c1
Sequence:CCGGCGGAATATGAACTGACTGCTTCTCGAGAAGCAGTCAGTTCATATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-1436s1c1
Sequence:CCGGCCTGCTTAGGTGTGAAGCAAACTCGAGTTTGCTTCACACCTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-1182s1c1
Sequence:CCGGCCTGATCTACATCGTCCTGAACTCGAGTTCAGGACGATGTAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-636s1c1
Sequence:CCGGCCGAGTGACTAAGGAGTTCATCTCGAGATGAACTCCTTAGTCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-879s1c1
Sequence:CCGGGCGTCTCTATAAATTTGTGTTCTCGAGAACACAAATTTATAGAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019983.2-1762s21c1
Sequence:CCGGCGGAATATGAACTGACTGCTTCTCGAGAAGCAGTCAGTTCATATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-636s21c1
Sequence:CCGGCCGAGTGACTAAGGAGTTCATCTCGAGATGAACTCCTTAGTCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-1182s21c1
Sequence:CCGGCCTGATCTACATCGTCCTGAACTCGAGTTCAGGACGATGTAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-879s21c1
Sequence:CCGGGCGTCTCTATAAATTTGTGTTCTCGAGAACACAAATTTATAGAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-1436s21c1
Sequence:CCGGCCTGCTTAGGTGTGAAGCAAACTCGAGTTTGCTTCACACCTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019983
RABGEF1 MISSION shRNA shRNA Plasmid DNA
RAB guanine nucleotide exchange factor (GEF) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019983.2-1762s1c1
Sequence:CCGGCGGAATATGAACTGACTGCTTCTCGAGAAGCAGTCAGTTCATATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-1436s1c1
Sequence:CCGGCCTGCTTAGGTGTGAAGCAAACTCGAGTTTGCTTCACACCTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-1182s1c1
Sequence:CCGGCCTGATCTACATCGTCCTGAACTCGAGTTCAGGACGATGTAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-636s1c1
Sequence:CCGGCCGAGTGACTAAGGAGTTCATCTCGAGATGAACTCCTTAGTCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-879s1c1
Sequence:CCGGGCGTCTCTATAAATTTGTGTTCTCGAGAACACAAATTTATAGAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019983.2-1762s21c1
Sequence:CCGGCGGAATATGAACTGACTGCTTCTCGAGAAGCAGTCAGTTCATATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-636s21c1
Sequence:CCGGCCGAGTGACTAAGGAGTTCATCTCGAGATGAACTCCTTAGTCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-1182s21c1
Sequence:CCGGCCTGATCTACATCGTCCTGAACTCGAGTTCAGGACGATGTAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-879s21c1
Sequence:CCGGGCGTCTCTATAAATTTGTGTTCTCGAGAACACAAATTTATAGAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-1436s21c1
Sequence:CCGGCCTGCTTAGGTGTGAAGCAAACTCGAGTTTGCTTCACACCTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019983
RABGEF1 MISSION shRNA Lentiviral Transduction Particles
RAB guanine nucleotide exchange factor (GEF) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019983.2-1762s1c1
Sequence:CCGGCGGAATATGAACTGACTGCTTCTCGAGAAGCAGTCAGTTCATATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-1436s1c1
Sequence:CCGGCCTGCTTAGGTGTGAAGCAAACTCGAGTTTGCTTCACACCTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-1182s1c1
Sequence:CCGGCCTGATCTACATCGTCCTGAACTCGAGTTCAGGACGATGTAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-636s1c1
Sequence:CCGGCCGAGTGACTAAGGAGTTCATCTCGAGATGAACTCCTTAGTCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019983.2-879s1c1
Sequence:CCGGGCGTCTCTATAAATTTGTGTTCTCGAGAACACAAATTTATAGAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019983.2-1762s21c1
Sequence:CCGGCGGAATATGAACTGACTGCTTCTCGAGAAGCAGTCAGTTCATATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-636s21c1
Sequence:CCGGCCGAGTGACTAAGGAGTTCATCTCGAGATGAACTCCTTAGTCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-1182s21c1
Sequence:CCGGCCTGATCTACATCGTCCTGAACTCGAGTTCAGGACGATGTAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-879s21c1
Sequence:CCGGGCGTCTCTATAAATTTGTGTTCTCGAGAACACAAATTTATAGAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019983.2-1436s21c1
Sequence:CCGGCCTGCTTAGGTGTGAAGCAAACTCGAGTTTGCTTCACACCTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014504
RABGEF1 MISSION shRNA Bacterial Glycerol Stock
RAB guanine nucleotide exchange factor (GEF) 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-1422s1c1
Sequence:CCGGGTTCAAGACATCGTTGAGAAACTCGAGTTTCTCAACGATGTCTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-1295s1c1
Sequence:CCGGCGTCAAGCAAATGTATAAGAACTCGAGTTCTTATACATTTGCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-889s1c1
Sequence:CCGGCGATCACAGATATCATTGAAACTCGAGTTTCAATGATATCTGTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-448s1c1
Sequence:CCGGGTCCTTCCATAAACCGGCAAACTCGAGTTTGCCGGTTTATGGAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-678s1c1
Sequence:CCGGCCAGAAAGAGTCGAGAAGATACTCGAGTATCTTCTCGACTCTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014504.2-1139s21c1
Sequence:CCGGCCACGCCTTCAGTCTAATATCCTCGAGGATATTAGACTGAAGGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014504.2-1620s21c1
Sequence:CCGGATGCAGGATGATCACAATTTACTCGAGTAAATTGTGATCATCCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014504
RABGEF1 MISSION shRNA shRNA Plasmid DNA
RAB guanine nucleotide exchange factor (GEF) 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-1422s1c1
Sequence:CCGGGTTCAAGACATCGTTGAGAAACTCGAGTTTCTCAACGATGTCTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-1295s1c1
Sequence:CCGGCGTCAAGCAAATGTATAAGAACTCGAGTTCTTATACATTTGCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-889s1c1
Sequence:CCGGCGATCACAGATATCATTGAAACTCGAGTTTCAATGATATCTGTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-448s1c1
Sequence:CCGGGTCCTTCCATAAACCGGCAAACTCGAGTTTGCCGGTTTATGGAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-678s1c1
Sequence:CCGGCCAGAAAGAGTCGAGAAGATACTCGAGTATCTTCTCGACTCTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014504.2-1139s21c1
Sequence:CCGGCCACGCCTTCAGTCTAATATCCTCGAGGATATTAGACTGAAGGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014504.2-1620s21c1
Sequence:CCGGATGCAGGATGATCACAATTTACTCGAGTAAATTGTGATCATCCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014504
RABGEF1 MISSION shRNA Lentiviral Transduction Particles
RAB guanine nucleotide exchange factor (GEF) 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-1422s1c1
Sequence:CCGGGTTCAAGACATCGTTGAGAAACTCGAGTTTCTCAACGATGTCTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-1295s1c1
Sequence:CCGGCGTCAAGCAAATGTATAAGAACTCGAGTTCTTATACATTTGCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-889s1c1
Sequence:CCGGCGATCACAGATATCATTGAAACTCGAGTTTCAATGATATCTGTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-448s1c1
Sequence:CCGGGTCCTTCCATAAACCGGCAAACTCGAGTTTGCCGGTTTATGGAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014504.1-678s1c1
Sequence:CCGGCCAGAAAGAGTCGAGAAGATACTCGAGTATCTTCTCGACTCTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014504.2-1139s21c1
Sequence:CCGGCCACGCCTTCAGTCTAATATCCTCGAGGATATTAGACTGAAGGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014504.2-1620s21c1
Sequence:CCGGATGCAGGATGATCACAATTTACTCGAGTAAATTGTGATCATCCTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)