EMAIL THIS PAGE TO A FRIEND

RABGGTB

Rab geranylgeranyltransferase, beta subunit

63 Gene Product Result for
Synonyms: GGTB
UniProtKB ID: P53611, Q92697
Gene ID:
Human(5876) Summary: This gene encodes the beta-subunit of the enzyme Rab geranylgeranyl-transferase (RabGGTase), which belongs to the protein prenyltransferase family. RabGGTase catalyzes the post-translational addition of geranylgeranyl groups to C-terminal cysteine residues of Rab GTPases. Three small nucleolar RNA genes are present in the intronic regions of this gene. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 3. [provided by RefSeq, Jan 2013]
Mouse(19352) RAB geranylgeranyl transferase, b subunit
Rat(25533) Rab geranylgeranyltransferase, beta subunit
domestic guinea pig(100715556) Rab geranylgeranyltransferase, beta subunit
naked mole-rat(101709927) Rab geranylgeranyltransferase, beta subunit
cow(533276) Rab geranylgeranyltransferase, beta subunit
sheep(100302071) Rab geranylgeranyltransferase, beta subunit
Zebrafish(406386) Rab geranylgeranyltransferase, beta subunit
dog(612683) Rab geranylgeranyltransferase, beta subunit
domestic cat(101090281) Rab geranylgeranyltransferase, beta subunit
chicken(424723) Rab geranylgeranyltransferase, beta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004582 Rosetta Predictions human pricing
NM_138708 Rosetta Predictions rat pricing
NM_011231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112524 predicted 478
2 SASI_Hs01_00112525 predicted 424
3 SASI_Hs01_00112526 predicted 910
4 SASI_Hs01_00112527 predicted 387
5 SASI_Hs02_00337927 predicted 916
6 SASI_Hs01_00112528 predicted 363
7 SASI_Hs02_00337928 predicted 841
8 SASI_Hs01_00112529 predicted 383
9 SASI_Hs01_00112530 predicted 532
10 SASI_Hs01_00112531 predicted 649
11 SASI_Hs01_00112532 predicted 672
12 SASI_Hs01_00112533 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095920 predicted 979
2 SASI_Rn01_00095921 predicted 804
3 SASI_Rn01_00095922 predicted 769
4 SASI_Rn01_00095923 predicted 344
5 SASI_Rn01_00095924 predicted 609
6 SASI_Rn01_00095926 predicted 857
7 SASI_Rn01_00095927 predicted 422
8 SASI_Rn01_00095928 predicted 1056
9 SASI_Rn02_00268192 predicted 976
10 SASI_Rn01_00095929 predicted 562
11 SASI_Rn01_00095925 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135194 predicted 335
2 SASI_Mm01_00135195 predicted 218
3 SASI_Mm01_00135196 predicted 436
4 SASI_Mm01_00135197 predicted 653
5 SASI_Mm01_00135198 predicted 222
6 SASI_Mm01_00135199 predicted 819
7 SASI_Mm01_00135200 predicted 385
8 SASI_Mm01_00135201 predicted 699
9 SASI_Mm01_00135202 predicted 356
10 SASI_Mm01_00135203 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011231
VALIDATED
RABGGTB MISSION shRNA Bacterial Glycerol Stock
Rab geranylgeranyltransferase, beta subunit
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-94s1c1
Sequence:CCGGGCCGATTATATTGCTTCCTATCTCGAGATAGGAAGCAATATAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-545s1c1
Sequence:CCGGGCATGAACTTTGATGGTGGATCTCGAGATCCACCATCAAAGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011231.1-143s1c1
Sequence:CCGGGCATGTCTGAATACCTGAGAACTCGAGTTCTCAGGTATTCAGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011231.1-883s1c1
Sequence:CCGGGATCCCTTTCATACCTTATTTCTCGAGAAATAAGGTATGAAAGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-226s1c1
Sequence:CCGGCGAGAAGAAATCCTGGTGTTTCTCGAGAAACACCAGGATTTCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-302s21c1
Sequence:GTACCGGTGAGAATGAGCGGCGTCTATTCTCGAGAATAGACGCCGCTCATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-1204s21c1
Sequence:CCGGTGCTGTATTTGAAGTGTTTATCTCGAGATAAACACTTCAAATACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-227s21c1
Sequence:CCGGTGGAGAAGCATGCCGATTATACTCGAGTATAATCGGCATGCTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-734s21c1
Sequence:CCGGCTCACGCTGGGCAGATCTATTCTCGAGAATAGATCTGCCCAGCGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-637s21c1
Sequence:CCGGGGCAAGCTTGATGCTATTAATCTCGAGATTAATAGCATCAAGCTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-1026s21c1
Sequence:CCGGGGATCCCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-918s21c1
Sequence:GTACCGGGATCATCGGGAGACTTCATTGCTCGAGCAATGAAGTCTCCCGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-260s21c1
Sequence:GTACCGGGCTCAAAGAAAGATGATTATGCTCGAGCATAATCATCTTTCTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-371s21c1
Sequence:GTACCGGGAGAAGAAATCCTGGTGTTTACTCGAGTAAACACCAGGATTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011231
VALIDATED
RABGGTB MISSION shRNA shRNA Plasmid DNA
Rab geranylgeranyltransferase, beta subunit
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-94s1c1
Sequence:CCGGGCCGATTATATTGCTTCCTATCTCGAGATAGGAAGCAATATAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-545s1c1
Sequence:CCGGGCATGAACTTTGATGGTGGATCTCGAGATCCACCATCAAAGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011231.1-143s1c1
Sequence:CCGGGCATGTCTGAATACCTGAGAACTCGAGTTCTCAGGTATTCAGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011231.1-883s1c1
Sequence:CCGGGATCCCTTTCATACCTTATTTCTCGAGAAATAAGGTATGAAAGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-226s1c1
Sequence:CCGGCGAGAAGAAATCCTGGTGTTTCTCGAGAAACACCAGGATTTCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-302s21c1
Sequence:GTACCGGTGAGAATGAGCGGCGTCTATTCTCGAGAATAGACGCCGCTCATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-1204s21c1
Sequence:CCGGTGCTGTATTTGAAGTGTTTATCTCGAGATAAACACTTCAAATACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-227s21c1
Sequence:CCGGTGGAGAAGCATGCCGATTATACTCGAGTATAATCGGCATGCTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-734s21c1
Sequence:CCGGCTCACGCTGGGCAGATCTATTCTCGAGAATAGATCTGCCCAGCGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-637s21c1
Sequence:CCGGGGCAAGCTTGATGCTATTAATCTCGAGATTAATAGCATCAAGCTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-1026s21c1
Sequence:CCGGGGATCCCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-918s21c1
Sequence:GTACCGGGATCATCGGGAGACTTCATTGCTCGAGCAATGAAGTCTCCCGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-260s21c1
Sequence:GTACCGGGCTCAAAGAAAGATGATTATGCTCGAGCATAATCATCTTTCTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-371s21c1
Sequence:GTACCGGGAGAAGAAATCCTGGTGTTTACTCGAGTAAACACCAGGATTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011231
VALIDATED
RABGGTB MISSION shRNA Lentiviral Transduction Particles
Rab geranylgeranyltransferase, beta subunit
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-94s1c1
Sequence:CCGGGCCGATTATATTGCTTCCTATCTCGAGATAGGAAGCAATATAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-545s1c1
Sequence:CCGGGCATGAACTTTGATGGTGGATCTCGAGATCCACCATCAAAGTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011231.1-143s1c1
Sequence:CCGGGCATGTCTGAATACCTGAGAACTCGAGTTCTCAGGTATTCAGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011231.1-883s1c1
Sequence:CCGGGATCCCTTTCATACCTTATTTCTCGAGAAATAAGGTATGAAAGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011231.1-226s1c1
Sequence:CCGGCGAGAAGAAATCCTGGTGTTTCTCGAGAAACACCAGGATTTCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-302s21c1
Sequence:GTACCGGTGAGAATGAGCGGCGTCTATTCTCGAGAATAGACGCCGCTCATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-1204s21c1
Sequence:CCGGTGCTGTATTTGAAGTGTTTATCTCGAGATAAACACTTCAAATACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-227s21c1
Sequence:CCGGTGGAGAAGCATGCCGATTATACTCGAGTATAATCGGCATGCTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-734s21c1
Sequence:CCGGCTCACGCTGGGCAGATCTATTCTCGAGAATAGATCTGCCCAGCGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-637s21c1
Sequence:CCGGGGCAAGCTTGATGCTATTAATCTCGAGATTAATAGCATCAAGCTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011231.2-1026s21c1
Sequence:CCGGGGATCCCTTTCATACCTTATTCTCGAGAATAAGGTATGAAAGGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-918s21c1
Sequence:GTACCGGGATCATCGGGAGACTTCATTGCTCGAGCAATGAAGTCTCCCGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-260s21c1
Sequence:GTACCGGGCTCAAAGAAAGATGATTATGCTCGAGCATAATCATCTTTCTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011231.2-371s21c1
Sequence:GTACCGGGAGAAGAAATCCTGGTGTTTACTCGAGTAAACACCAGGATTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004582
VALIDATED
RABGGTB MISSION shRNA Bacterial Glycerol Stock
Rab geranylgeranyltransferase, beta subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_004582.2-304s1c1
Sequence:CCGGGCCAACATGAATGTGGTGGAACTCGAGTTCCACCACATTCATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-253s1c1
Sequence:CCGGGACAACTTCATCGCATGAATACTCGAGTATTCATGCGATGAAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-768s1c1
Sequence:CCGGCCGGAGAAGTTACCAGATGTACTCGAGTACATCTGGTAACTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-661s1c1
Sequence:CCGGGCACAGGATTTCTGGCTATTACTCGAGTAATAGCCAGAAATCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004582.2-141s1c1
Sequence:CCGGGCAGATTATATCGCATCCTATCTCGAGATAGGATGCGATATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004582.2-1125s21c1
Sequence:GTACCGGGAAGTGCTTATCGAATCTAAACTCGAGTTTAGATTCGATAAGCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-768s21c1
Sequence:CCGGCCGGAGAAGTTACCAGATGTACTCGAGTACATCTGGTAACTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-304s21c1
Sequence:CCGGGCCAACATGAATGTGGTGGAACTCGAGTTCCACCACATTCATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-253s21c1
Sequence:CCGGGACAACTTCATCGCATGAATACTCGAGTATTCATGCGATGAAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-141s21c1
Sequence:CCGGGCAGATTATATCGCATCCTATCTCGAGATAGGATGCGATATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004582.2-661s21c1
Sequence:CCGGGCACAGGATTTCTGGCTATTACTCGAGTAATAGCCAGAAATCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004582
VALIDATED
RABGGTB MISSION shRNA shRNA Plasmid DNA
Rab geranylgeranyltransferase, beta subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_004582.2-304s1c1
Sequence:CCGGGCCAACATGAATGTGGTGGAACTCGAGTTCCACCACATTCATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-253s1c1
Sequence:CCGGGACAACTTCATCGCATGAATACTCGAGTATTCATGCGATGAAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-768s1c1
Sequence:CCGGCCGGAGAAGTTACCAGATGTACTCGAGTACATCTGGTAACTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-661s1c1
Sequence:CCGGGCACAGGATTTCTGGCTATTACTCGAGTAATAGCCAGAAATCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004582.2-141s1c1
Sequence:CCGGGCAGATTATATCGCATCCTATCTCGAGATAGGATGCGATATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004582.2-1125s21c1
Sequence:GTACCGGGAAGTGCTTATCGAATCTAAACTCGAGTTTAGATTCGATAAGCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-768s21c1
Sequence:CCGGCCGGAGAAGTTACCAGATGTACTCGAGTACATCTGGTAACTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-304s21c1
Sequence:CCGGGCCAACATGAATGTGGTGGAACTCGAGTTCCACCACATTCATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-253s21c1
Sequence:CCGGGACAACTTCATCGCATGAATACTCGAGTATTCATGCGATGAAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-141s21c1
Sequence:CCGGGCAGATTATATCGCATCCTATCTCGAGATAGGATGCGATATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004582.2-661s21c1
Sequence:CCGGGCACAGGATTTCTGGCTATTACTCGAGTAATAGCCAGAAATCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004582
VALIDATED
RABGGTB MISSION shRNA Lentiviral Transduction Particles
Rab geranylgeranyltransferase, beta subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_004582.2-304s1c1
Sequence:CCGGGCCAACATGAATGTGGTGGAACTCGAGTTCCACCACATTCATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-253s1c1
Sequence:CCGGGACAACTTCATCGCATGAATACTCGAGTATTCATGCGATGAAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-768s1c1
Sequence:CCGGCCGGAGAAGTTACCAGATGTACTCGAGTACATCTGGTAACTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004582.2-661s1c1
Sequence:CCGGGCACAGGATTTCTGGCTATTACTCGAGTAATAGCCAGAAATCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004582.2-141s1c1
Sequence:CCGGGCAGATTATATCGCATCCTATCTCGAGATAGGATGCGATATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004582.2-1125s21c1
Sequence:GTACCGGGAAGTGCTTATCGAATCTAAACTCGAGTTTAGATTCGATAAGCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-768s21c1
Sequence:CCGGCCGGAGAAGTTACCAGATGTACTCGAGTACATCTGGTAACTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-304s21c1
Sequence:CCGGGCCAACATGAATGTGGTGGAACTCGAGTTCCACCACATTCATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-253s21c1
Sequence:CCGGGACAACTTCATCGCATGAATACTCGAGTATTCATGCGATGAAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004582.2-141s21c1
Sequence:CCGGGCAGATTATATCGCATCCTATCTCGAGATAGGATGCGATATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004582.2-661s21c1
Sequence:CCGGGCACAGGATTTCTGGCTATTACTCGAGTAATAGCCAGAAATCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)