EMAIL THIS PAGE TO A FRIEND

RABIF

RAB interacting factor

60 Gene Product Result for
Synonyms: MSS4 RASGFR3 RASGRF3
UniProtKB ID: P47224, B2R4P4, Q92992
Gene ID:
Human(5877) Summary: This gene encodes a member of the SCE4/YPT1/RAB family of small GTP-binding proteins that are involved in the regulation of intracellular vesicular transport. This protein stimulates GTP-GDP exchange in SEC4, and to a lesser extent in YPT1 and RAB3A, and may play a general role in vesicular transport. [provided by RefSeq, Oct 2011]
Mouse(98710) RAB interacting factor
Rat(304807) RAB interacting factor
Zebrafish(436784) RAB interacting factor
dog(479997) RAB interacting factor
domestic cat(101080423) RAB interacting factor
chicken(421170) RAB interacting factor
naked mole-rat(101710398) RAB interacting factor
cow(616779) RAB interacting factor
sheep(101110078) RAB interacting factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002871 Rosetta Predictions human pricing
NM_001007678 Rosetta Predictions rat pricing
NM_145510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230747 predicted 502
2 SASI_Hs01_00230748 predicted 586
3 SASI_Hs02_00334645 predicted 412
4 SASI_Hs01_00230749 predicted 848
5 SASI_Hs01_00230750 predicted 868
6 SASI_Hs01_00230751 predicted 757
7 SASI_Hs01_00230752 predicted 817
8 SASI_Hs01_00230753 predicted 784
9 SASI_Hs01_00230754 predicted 454
10 SASI_Hs01_00230755 predicted 389
11 SASI_Hs01_00230756 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198809 predicted 685
2 SASI_Rn02_00198810 predicted 700
3 SASI_Rn02_00198811 predicted 494
4 SASI_Rn02_00198812 predicted 726
5 SASI_Rn02_00198813 predicted 191
6 SASI_Rn02_00198814 predicted 522
7 SASI_Rn02_00198815 predicted 870
8 SASI_Rn02_00198816 predicted 697
9 SASI_Rn02_00198817 predicted 465
10 SASI_Rn02_00198818 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197120 predicted 632
2 SASI_Mm01_00197121 predicted 266
3 SASI_Mm01_00197122 predicted 643
4 SASI_Mm01_00197123 predicted 357
5 SASI_Mm01_00197124 predicted 329
6 SASI_Mm01_00197125 predicted 806
7 SASI_Mm02_00340960 predicted 296
8 SASI_Mm01_00197126 predicted 595
9 SASI_Mm01_00197127 predicted 311
10 SASI_Mm01_00197129 predicted 369
11 SASI_Mm01_00197128 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002871
VALIDATED
RABIF MISSION shRNA Bacterial Glycerol Stock
RAB interacting factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002871.3-379s21c1
Sequence:CCGGTGTGGCCTTGGAACGAGTTTCCTCGAGGAAACTCGTTCCAAGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002871.3-246s21c1
Sequence:CCGGTGGTTGAGGACATGTTCATTTCTCGAGAAATGAACATGTCCTCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002871.3-356s21c1
Sequence:CCGGCTAGATGACAAGAACAGTTTCCTCGAGGAAACTGTTCTTGTCATCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002871.3-291s21c1
Sequence:CCGGACGTGGGCAACATCAAGTTTCCTCGAGGAAACTTGATGTTGCCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-323s1c1
Sequence:CCGGGACTGTGAAATTGGACCAATTCTCGAGAATTGGTCCAATTTCACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002871.3-544s21c1
Sequence:CCGGTTGAACATGCAGAGGGTTAATCTCGAGATTAACCCTCTGCATGTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-194s1c1
Sequence:CCGGGCTCTGTCTGACGGCAGCAATCTCGAGATTGCTGCCGTCAGACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002871.3-1471s1c1
Sequence:CCGGGCCTTCAACTTGATTTCCAATCTCGAGATTGGAAATCAAGTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-355s1c1
Sequence:CCGGCCTAGATGACAAGAACAGTTTCTCGAGAAACTGTTCTTGTCATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002871.3-290s1c1
Sequence:CCGGGACGTGGGCAACATCAAGTTTCTCGAGAAACTTGATGTTGCCCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002871
VALIDATED
RABIF MISSION shRNA shRNA Plasmid DNA
RAB interacting factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002871.3-379s21c1
Sequence:CCGGTGTGGCCTTGGAACGAGTTTCCTCGAGGAAACTCGTTCCAAGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002871.3-246s21c1
Sequence:CCGGTGGTTGAGGACATGTTCATTTCTCGAGAAATGAACATGTCCTCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002871.3-356s21c1
Sequence:CCGGCTAGATGACAAGAACAGTTTCCTCGAGGAAACTGTTCTTGTCATCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002871.3-291s21c1
Sequence:CCGGACGTGGGCAACATCAAGTTTCCTCGAGGAAACTTGATGTTGCCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-323s1c1
Sequence:CCGGGACTGTGAAATTGGACCAATTCTCGAGAATTGGTCCAATTTCACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002871.3-544s21c1
Sequence:CCGGTTGAACATGCAGAGGGTTAATCTCGAGATTAACCCTCTGCATGTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-194s1c1
Sequence:CCGGGCTCTGTCTGACGGCAGCAATCTCGAGATTGCTGCCGTCAGACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002871.3-1471s1c1
Sequence:CCGGGCCTTCAACTTGATTTCCAATCTCGAGATTGGAAATCAAGTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-355s1c1
Sequence:CCGGCCTAGATGACAAGAACAGTTTCTCGAGAAACTGTTCTTGTCATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002871.3-290s1c1
Sequence:CCGGGACGTGGGCAACATCAAGTTTCTCGAGAAACTTGATGTTGCCCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002871
VALIDATED
RABIF MISSION shRNA Lentiviral Transduction Particles
RAB interacting factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002871.3-379s21c1
Sequence:CCGGTGTGGCCTTGGAACGAGTTTCCTCGAGGAAACTCGTTCCAAGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002871.3-246s21c1
Sequence:CCGGTGGTTGAGGACATGTTCATTTCTCGAGAAATGAACATGTCCTCAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002871.3-356s21c1
Sequence:CCGGCTAGATGACAAGAACAGTTTCCTCGAGGAAACTGTTCTTGTCATCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002871.3-291s21c1
Sequence:CCGGACGTGGGCAACATCAAGTTTCCTCGAGGAAACTTGATGTTGCCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-323s1c1
Sequence:CCGGGACTGTGAAATTGGACCAATTCTCGAGAATTGGTCCAATTTCACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002871.3-544s21c1
Sequence:CCGGTTGAACATGCAGAGGGTTAATCTCGAGATTAACCCTCTGCATGTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-194s1c1
Sequence:CCGGGCTCTGTCTGACGGCAGCAATCTCGAGATTGCTGCCGTCAGACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002871.3-1471s1c1
Sequence:CCGGGCCTTCAACTTGATTTCCAATCTCGAGATTGGAAATCAAGTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002871.3-355s1c1
Sequence:CCGGCCTAGATGACAAGAACAGTTTCTCGAGAAACTGTTCTTGTCATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002871.3-290s1c1
Sequence:CCGGGACGTGGGCAACATCAAGTTTCTCGAGAAACTTGATGTTGCCCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145510
VALIDATED
RABIF MISSION shRNA Bacterial Glycerol Stock
RAB interacting factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145510.1-483s21c1
Sequence:CCGGGCAGACTTGTTGGTACTAATACTCGAGTATTAGTACCAACAAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-354s21c1
Sequence:CCGGGAACAGCTTCTATGTGGCCTTCTCGAGAAGGCCACATAGAAGCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-249s21c1
Sequence:CCGGCACCTTTGAGAATGTGGGCTTCTCGAGAAGCCCACATTCTCAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-336s21c1
Sequence:CCGGGCATTGCCTAGATGACAAGAACTCGAGTTCTTGTCATCTAGGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-483s1c1
Sequence:CCGGGCAGACTTGTTGGTACTAATACTCGAGTATTAGTACCAACAAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-342s1c1
Sequence:CCGGCCTAGATGACAAGAACAGCTTCTCGAGAAGCTGTTCTTGTCATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-354s1c1
Sequence:CCGGGAACAGCTTCTATGTGGCCTTCTCGAGAAGGCCACATAGAAGCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-249s1c1
Sequence:CCGGCACCTTTGAGAATGTGGGCTTCTCGAGAAGCCCACATTCTCAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145510.1-336s1c1
Sequence:CCGGGCATTGCCTAGATGACAAGAACTCGAGTTCTTGTCATCTAGGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145510
VALIDATED
RABIF MISSION shRNA shRNA Plasmid DNA
RAB interacting factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145510.1-483s21c1
Sequence:CCGGGCAGACTTGTTGGTACTAATACTCGAGTATTAGTACCAACAAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-354s21c1
Sequence:CCGGGAACAGCTTCTATGTGGCCTTCTCGAGAAGGCCACATAGAAGCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-249s21c1
Sequence:CCGGCACCTTTGAGAATGTGGGCTTCTCGAGAAGCCCACATTCTCAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-336s21c1
Sequence:CCGGGCATTGCCTAGATGACAAGAACTCGAGTTCTTGTCATCTAGGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-483s1c1
Sequence:CCGGGCAGACTTGTTGGTACTAATACTCGAGTATTAGTACCAACAAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-342s1c1
Sequence:CCGGCCTAGATGACAAGAACAGCTTCTCGAGAAGCTGTTCTTGTCATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-354s1c1
Sequence:CCGGGAACAGCTTCTATGTGGCCTTCTCGAGAAGGCCACATAGAAGCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-249s1c1
Sequence:CCGGCACCTTTGAGAATGTGGGCTTCTCGAGAAGCCCACATTCTCAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145510.1-336s1c1
Sequence:CCGGGCATTGCCTAGATGACAAGAACTCGAGTTCTTGTCATCTAGGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145510
VALIDATED
RABIF MISSION shRNA Lentiviral Transduction Particles
RAB interacting factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145510.1-483s21c1
Sequence:CCGGGCAGACTTGTTGGTACTAATACTCGAGTATTAGTACCAACAAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-354s21c1
Sequence:CCGGGAACAGCTTCTATGTGGCCTTCTCGAGAAGGCCACATAGAAGCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-249s21c1
Sequence:CCGGCACCTTTGAGAATGTGGGCTTCTCGAGAAGCCCACATTCTCAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145510.1-336s21c1
Sequence:CCGGGCATTGCCTAGATGACAAGAACTCGAGTTCTTGTCATCTAGGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-483s1c1
Sequence:CCGGGCAGACTTGTTGGTACTAATACTCGAGTATTAGTACCAACAAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-342s1c1
Sequence:CCGGCCTAGATGACAAGAACAGCTTCTCGAGAAGCTGTTCTTGTCATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-354s1c1
Sequence:CCGGGAACAGCTTCTATGTGGCCTTCTCGAGAAGGCCACATAGAAGCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145510.1-249s1c1
Sequence:CCGGCACCTTTGAGAATGTGGGCTTCTCGAGAAGCCCACATTCTCAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145510.1-336s1c1
Sequence:CCGGGCATTGCCTAGATGACAAGAACTCGAGTTCTTGTCATCTAGGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)