EMAIL THIS PAGE TO A FRIEND

RABL2A

RAB, member of RAS oncogene family-like 2A

46 Gene Product Result for
UniProtKB ID: Q9UBK7, B7ZBD6, Q9NU37
Gene ID:
Human(11159) Summary: This gene is a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Two alternatively spliced transcript variants have been identified, both encoding the same protein. [provided by RefSeq, Jul 2008]
Rat(362987) RAB, member of RAS oncogene family-like 2A
sheep(100145873) RAB, member of RAS oncogene family-like 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007082 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007082 Rosetta Predictions human pricing
NM_013412 Rosetta Predictions human pricing
NM_001013221 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194154 predicted 596
2 SASI_Hs01_00194155 predicted 407
3 SASI_Hs01_00194156 predicted 316
4 SASI_Hs02_00342920 predicted 252
5 SASI_Hs01_00194157 predicted 290
6 SASI_Hs01_00194158 predicted 355
7 SASI_Hs01_00194159 predicted 466
8 SASI_Hs01_00194161 predicted 381
9 SASI_Hs01_00194162 predicted 499
10 SASI_Hs02_00342921 predicted 690
11 SASI_Hs01_00194153 predicted 441
12 SASI_Hs01_00194160 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061061 predicted 590
2 SASI_Hs01_00061062 predicted 407
3 SASI_Hs01_00061063 predicted 322
4 SASI_Hs02_00344800 predicted 247
5 SASI_Hs01_00061064 predicted 293
6 SASI_Hs01_00061065 predicted 348
7 SASI_Hs01_00061066 predicted 466
8 SASI_Hs01_00061068 predicted 385
9 SASI_Hs01_00061069 predicted 496
10 SASI_Hs02_00344801 predicted 694
11 SASI_Hs01_00061060 predicted 444
12 SASI_Hs01_00061067 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087742 predicted 744
2 SASI_Rn02_00201023 predicted 1260
3 SASI_Rn01_00087744 predicted 379
4 SASI_Rn01_00087745 predicted 842
5 SASI_Rn01_00087746 predicted 1045
6 SASI_Rn01_00087747 predicted 1115
7 SASI_Rn01_00087748 predicted 821
8 SASI_Rn01_00087749 predicted 862
9 SASI_Rn01_00087750 predicted 939
10 SASI_Rn02_00201024 predicted 1271
11 SASI_Rn01_00087743 predicted 829
12 SASI_Rn01_00087751 predicted 1291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007082
RABL2A MISSION shRNA Bacterial Glycerol Stock
RAB, member of RAS oncogene family-like 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007082.3-963s21c1
Sequence:CCGGAGAGGAGAGCTAGCAGATATGCTCGAGCATATCTGCTAGCTCTCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007082.3-596s21c1
Sequence:CCGGTGCATCGTGGTGGCCAATAAACTCGAGTTTATTGGCCACCACGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007082.3-708s21c1
Sequence:CCGGATGTTGTGAAGCTCTTCAATGCTCGAGCATTGAAGAGCTTCACAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-705s1c1
Sequence:CCGGCCAGGACTTCATGGATGAGATCTCGAGATCTCATCCATGAAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-676s1c1
Sequence:CCGGCGATTAGCTGTGTCTTACAAACTCGAGTTTGTAAGACACAGCTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-439s1c1
Sequence:CCGGGCCTGCATCATGGTGTTTGATCTCGAGATCAAACACCATGATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-312s1c1
Sequence:CCGGGTACGCCCTGACCCTGTACAACTCGAGTTGTACAGGGTCAGGGCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-190s1c1
Sequence:CCGGCAAGGGAAGTATGATGCTGATCTCGAGATCAGCATCATACTTCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007082
RABL2A MISSION shRNA shRNA Plasmid DNA
RAB, member of RAS oncogene family-like 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007082.3-963s21c1
Sequence:CCGGAGAGGAGAGCTAGCAGATATGCTCGAGCATATCTGCTAGCTCTCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007082.3-596s21c1
Sequence:CCGGTGCATCGTGGTGGCCAATAAACTCGAGTTTATTGGCCACCACGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007082.3-708s21c1
Sequence:CCGGATGTTGTGAAGCTCTTCAATGCTCGAGCATTGAAGAGCTTCACAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-705s1c1
Sequence:CCGGCCAGGACTTCATGGATGAGATCTCGAGATCTCATCCATGAAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-676s1c1
Sequence:CCGGCGATTAGCTGTGTCTTACAAACTCGAGTTTGTAAGACACAGCTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-439s1c1
Sequence:CCGGGCCTGCATCATGGTGTTTGATCTCGAGATCAAACACCATGATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-312s1c1
Sequence:CCGGGTACGCCCTGACCCTGTACAACTCGAGTTGTACAGGGTCAGGGCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-190s1c1
Sequence:CCGGCAAGGGAAGTATGATGCTGATCTCGAGATCAGCATCATACTTCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007082
RABL2A MISSION shRNA Lentiviral Transduction Particles
RAB, member of RAS oncogene family-like 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007082.3-963s21c1
Sequence:CCGGAGAGGAGAGCTAGCAGATATGCTCGAGCATATCTGCTAGCTCTCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007082.3-596s21c1
Sequence:CCGGTGCATCGTGGTGGCCAATAAACTCGAGTTTATTGGCCACCACGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007082.3-708s21c1
Sequence:CCGGATGTTGTGAAGCTCTTCAATGCTCGAGCATTGAAGAGCTTCACAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-705s1c1
Sequence:CCGGCCAGGACTTCATGGATGAGATCTCGAGATCTCATCCATGAAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-676s1c1
Sequence:CCGGCGATTAGCTGTGTCTTACAAACTCGAGTTTGTAAGACACAGCTAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-439s1c1
Sequence:CCGGGCCTGCATCATGGTGTTTGATCTCGAGATCAAACACCATGATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-312s1c1
Sequence:CCGGGTACGCCCTGACCCTGTACAACTCGAGTTGTACAGGGTCAGGGCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007082.2-190s1c1
Sequence:CCGGCAAGGGAAGTATGATGCTGATCTCGAGATCAGCATCATACTTCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)