EMAIL THIS PAGE TO A FRIEND

RABL2B

RAB, member of RAS oncogene family-like 2B

31 Gene Product Result for
UniProtKB ID: Q9UNT1, Q5TZT8, Q96C33
Gene ID:
Human(11158) Summary: The RABL2B protein is a member of the RAB gene family which belongs to the RAS GTPase superfamily. RABL2B is located within a subtelomeric region of 22q13.3. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
sheep(100145874) RAB, member of RAS oncogene family-like 2B
chicken(426865) RAB, member of RAS oncogene family-like 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003789 Rosetta Predictions human pricing
NM_007081 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137371 predicted 373
2 SASI_Hs01_00137372 predicted 1022
3 SASI_Hs01_00137373 predicted 369
4 SASI_Hs02_00304374 predicted 965
5 SASI_Hs02_00304375 predicted 961
6 SASI_Hs02_00304376 predicted 371
7 SASI_Hs01_00137374 predicted 969
8 SASI_Hs01_00137375 predicted 390
9 SASI_Hs01_00137376 predicted 1023
10 SASI_Hs01_00137377 predicted 387
11 SASI_Hs01_00137378 predicted 834
12 SASI_Hs01_00137379 predicted 1006
13 SASI_Hs01_00137380 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140971 predicted 373
2 SASI_Hs01_00140972 predicted 1016
3 SASI_Hs01_00140973 predicted 363
4 SASI_Hs02_00342917 predicted 953
5 SASI_Hs02_00342918 predicted 948
6 SASI_Hs02_00342919 predicted 367
7 SASI_Hs01_00140974 predicted 953
8 SASI_Hs01_00140975 predicted 379
9 SASI_Hs01_00140976 predicted 1017
10 SASI_Hs01_00140977 predicted 392
11 SASI_Hs01_00140978 predicted 835
12 SASI_Hs01_00140979 predicted 1002
13 SASI_Hs01_00140980 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003789
VALIDATED
RABL2B MISSION shRNA Bacterial Glycerol Stock
RAB, member of RAS oncogene family-like 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003789.1-1835s1c1
Sequence:CCGGGCCTAGCTATAGTTAGGAATACTCGAGTATTCCTAACTATAGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003789.1-418s1c1
Sequence:CCGGAGGACCATCCTTGTGGACTTTCTCGAGAAAGTCCACAAGGATGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003789.1-625s1c1
Sequence:CCGGGCAGACATAAACGTGACCCAACTCGAGTTGGGTCACGTTTATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003789.1-319s1c1
Sequence:CCGGTCCAAACTCATGGAGAGATTTCTCGAGAAATCTCTCCATGAGTTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003789.1-773s21c1
Sequence:CCGGAGGACTTCATGGATGAGATTTCTCGAGAAATCTCATCCATGAAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003789.1-270s1c1
Sequence:CCGGTGATGACAACGTGAAGATCATCTCGAGATGATCTTCACGTTGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003789.1-500s21c1
Sequence:CCGGACGCCTGCATCATGGTGTTTGCTCGAGCAAACACCATGATGCAGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003789
VALIDATED
RABL2B MISSION shRNA shRNA Plasmid DNA
RAB, member of RAS oncogene family-like 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003789.1-1835s1c1
Sequence:CCGGGCCTAGCTATAGTTAGGAATACTCGAGTATTCCTAACTATAGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003789.1-418s1c1
Sequence:CCGGAGGACCATCCTTGTGGACTTTCTCGAGAAAGTCCACAAGGATGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003789.1-625s1c1
Sequence:CCGGGCAGACATAAACGTGACCCAACTCGAGTTGGGTCACGTTTATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003789.1-319s1c1
Sequence:CCGGTCCAAACTCATGGAGAGATTTCTCGAGAAATCTCTCCATGAGTTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003789.1-773s21c1
Sequence:CCGGAGGACTTCATGGATGAGATTTCTCGAGAAATCTCATCCATGAAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003789.1-270s1c1
Sequence:CCGGTGATGACAACGTGAAGATCATCTCGAGATGATCTTCACGTTGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003789.1-500s21c1
Sequence:CCGGACGCCTGCATCATGGTGTTTGCTCGAGCAAACACCATGATGCAGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003789
VALIDATED
RABL2B MISSION shRNA Lentiviral Transduction Particles
RAB, member of RAS oncogene family-like 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003789.1-1835s1c1
Sequence:CCGGGCCTAGCTATAGTTAGGAATACTCGAGTATTCCTAACTATAGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003789.1-418s1c1
Sequence:CCGGAGGACCATCCTTGTGGACTTTCTCGAGAAAGTCCACAAGGATGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003789.1-625s1c1
Sequence:CCGGGCAGACATAAACGTGACCCAACTCGAGTTGGGTCACGTTTATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003789.1-319s1c1
Sequence:CCGGTCCAAACTCATGGAGAGATTTCTCGAGAAATCTCTCCATGAGTTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003789.1-773s21c1
Sequence:CCGGAGGACTTCATGGATGAGATTTCTCGAGAAATCTCATCCATGAAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003789.1-270s1c1
Sequence:CCGGTGATGACAACGTGAAGATCATCTCGAGATGATCTTCACGTTGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003789.1-500s21c1
Sequence:CCGGACGCCTGCATCATGGTGTTTGCTCGAGCAAACACCATGATGCAGGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)