EMAIL THIS PAGE TO A FRIEND

RABL5

RAB, member RAS oncogene family-like 5

99 Gene Product Result for
UniProtKB ID: Q9H7X7, Q49AG1, Q69YV5, Q9BSW4
Gene ID:
Mouse(67286) RAB, member of RAS oncogene family-like 5
Rat(288585) RAB, member RAS oncogene family-like 5
naked mole-rat(101699279) RAB, member RAS oncogene family-like 5
domestic guinea pig(100714672) RAB, member RAS oncogene family-like 5
cow(516107) RAB, member RAS oncogene family-like 5
sheep(101120796) RAB, member RAS oncogene family-like 5
Zebrafish(550583) RAB, member RAS oncogene family-like 5
chicken(417503) RAB, member RAS oncogene family-like 5
dog(479727) RAB, member RAS oncogene family-like 5
domestic cat(101089916) RAB, member RAS oncogene family-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022777 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022777 Rosetta Predictions human pricing
NM_001011902 Rosetta Predictions rat pricing
XM_573385 Rosetta Predictions rat pricing
NM_026073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125664 predicted 341
2 SASI_Hs01_00125666 predicted 645
3 SASI_Hs01_00125667 predicted 736
4 SASI_Hs01_00125668 predicted 627
5 SASI_Hs01_00125669 predicted 224
6 SASI_Hs01_00125670 predicted 322
7 SASI_Hs01_00125672 predicted 514
8 SASI_Hs02_00356070 predicted 699
9 SASI_Hs01_00125673 predicted 336
10 SASI_Hs02_00356071 predicted 635
11 SASI_Hs01_00125665 predicted 337
12 SASI_Hs01_00125671 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046396 predicted 581
2 SASI_Rn01_00046397 predicted 221
3 SASI_Rn01_00046398 predicted 637
4 SASI_Rn01_00046400 predicted 389
5 SASI_Rn01_00046401 predicted 748
6 SASI_Rn01_00046402 predicted 390
7 SASI_Rn01_00046403 predicted 269
8 SASI_Rn01_00046404 predicted 259
9 SASI_Rn02_00199892 predicted 349
10 SASI_Rn02_00199893 predicted 204
11 SASI_Rn01_00046399 predicted 294
12 SASI_Rn01_00046405 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143397 predicted 586
2 SASI_Rn01_00143398 predicted 231
3 SASI_Rn01_00143399 predicted 649
4 SASI_Rn01_00143400 predicted 298
5 SASI_Rn01_00143401 predicted 391
6 SASI_Rn01_00143402 predicted 394
7 SASI_Rn01_00143403 predicted 272
8 SASI_Rn01_00143404 predicted 260
9 SASI_Rn01_00143405 predicted 306
10 SASI_Rn01_00143406 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116273 predicted 556
2 SASI_Mm02_00329637 predicted 353
3 SASI_Mm01_00116274 predicted 537
4 SASI_Mm01_00116282 predicted 273
5 SASI_Mm02_00329638 predicted 327
6 SASI_Mm02_00329639 predicted 209
7 SASI_Mm02_00329640 predicted 267
8 SASI_Mm02_00329641 predicted 342
9 SASI_Mm02_00329642 predicted 325
10 SASI_Mm01_00116277 predicted 369
11 SASI_Mm01_00116275 predicted 267
12 SASI_Mm01_00116276 predicted 370
13 SASI_Mm01_00116278 predicted 321
14 SASI_Mm01_00116279 predicted 384
15 SASI_Mm01_00116280 predicted 659
16 SASI_Mm01_00116281 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026073
VALIDATED
RABL5 MISSION shRNA Bacterial Glycerol Stock
RAB, member RAS oncogene family-like 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-363s1c1
Sequence:CCGGGCCACCTAAAGGAAATTGAAACTCGAGTTTCAATTTCCTTTAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-364s1c1
Sequence:CCGGCCACCTAAAGGAAATTGAAATCTCGAGATTTCAATTTCCTTTAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-557s1c1
Sequence:CCGGGTGGAGTTCATCAAGTATTTACTCGAGTAAATACTTGATGAACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-159s21c1
Sequence:CCGGCTTCGGACATCACTGAATATACTCGAGTATATTCAGTGATGTCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.3-337s1c1
Sequence:CCGGGATCGTCTTCAATGCTGATATCTCGAGATATCAGCATTGAAGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-556s21c1
Sequence:CCGGGGTGGAGTTCATCAAGTATTTCTCGAGAAATACTTGATGAACTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-659s21c1
Sequence:CCGGTCCCAAAGGACGCTGACTAACCTCGAGGTTAGTCAGCGTCCTTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-339s21c1
Sequence:CCGGTCGTCTTCAATGCTGATATTCCTCGAGGAATATCAGCATTGAAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-509s21c1
Sequence:CCGGCTGAAGCTGGTGCACTCAAACCTCGAGGTTTGAGTGCACCAGCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026073
VALIDATED
RABL5 MISSION shRNA shRNA Plasmid DNA
RAB, member RAS oncogene family-like 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-363s1c1
Sequence:CCGGGCCACCTAAAGGAAATTGAAACTCGAGTTTCAATTTCCTTTAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-364s1c1
Sequence:CCGGCCACCTAAAGGAAATTGAAATCTCGAGATTTCAATTTCCTTTAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-557s1c1
Sequence:CCGGGTGGAGTTCATCAAGTATTTACTCGAGTAAATACTTGATGAACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-159s21c1
Sequence:CCGGCTTCGGACATCACTGAATATACTCGAGTATATTCAGTGATGTCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.3-337s1c1
Sequence:CCGGGATCGTCTTCAATGCTGATATCTCGAGATATCAGCATTGAAGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-556s21c1
Sequence:CCGGGGTGGAGTTCATCAAGTATTTCTCGAGAAATACTTGATGAACTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-659s21c1
Sequence:CCGGTCCCAAAGGACGCTGACTAACCTCGAGGTTAGTCAGCGTCCTTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-339s21c1
Sequence:CCGGTCGTCTTCAATGCTGATATTCCTCGAGGAATATCAGCATTGAAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-509s21c1
Sequence:CCGGCTGAAGCTGGTGCACTCAAACCTCGAGGTTTGAGTGCACCAGCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026073
VALIDATED
RABL5 MISSION shRNA Lentiviral Transduction Particles
RAB, member RAS oncogene family-like 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-363s1c1
Sequence:CCGGGCCACCTAAAGGAAATTGAAACTCGAGTTTCAATTTCCTTTAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-364s1c1
Sequence:CCGGCCACCTAAAGGAAATTGAAATCTCGAGATTTCAATTTCCTTTAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.2-557s1c1
Sequence:CCGGGTGGAGTTCATCAAGTATTTACTCGAGTAAATACTTGATGAACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-159s21c1
Sequence:CCGGCTTCGGACATCACTGAATATACTCGAGTATATTCAGTGATGTCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026073.3-337s1c1
Sequence:CCGGGATCGTCTTCAATGCTGATATCTCGAGATATCAGCATTGAAGACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-556s21c1
Sequence:CCGGGGTGGAGTTCATCAAGTATTTCTCGAGAAATACTTGATGAACTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-659s21c1
Sequence:CCGGTCCCAAAGGACGCTGACTAACCTCGAGGTTAGTCAGCGTCCTTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-339s21c1
Sequence:CCGGTCGTCTTCAATGCTGATATTCCTCGAGGAATATCAGCATTGAAGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026073.3-509s21c1
Sequence:CCGGCTGAAGCTGGTGCACTCAAACCTCGAGGTTTGAGTGCACCAGCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022777
VALIDATED
RABL5 MISSION shRNA Bacterial Glycerol Stock
RAB, member RAS oncogene family-like 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-626s1c1
Sequence:CCGGCCCAGTGAAATCAGCATGTTTCTCGAGAAACATGCTGATTTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-511s1c1
Sequence:CCGGCCGGATGGAATTCATAAAGTACTCGAGTACTTTATGAATTCCATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-451s1c1
Sequence:CCGGGCCACCCTTGAACAAGCTGAACTCGAGTTCAGCTTGTTCAAGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-439s1c1
Sequence:CCGGCCTGTCTTTGTCGCCACCCTTCTCGAGAAGGGTGGCGACAAAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-178s1c1
Sequence:CCGGGCATGTTACCAGCAACAACAACTCGAGTTGTTGTTGCTGGTAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022777.1-237s1c1
Sequence:CCGGGCGATGCTAAGTTTGAGTCCTCTCGAGAGGACTCAAACTTAGCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-178s1c2
Sequence:CCGGGCATGTTACCAGCAACAACAACTCGAGTTGTTGTTGCTGGTAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-395s1c1
Sequence:CCGGCTAATTGCACACCACAAACCACTCGAGTGGTTTGTGGTGTGCAATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-99s1c1
Sequence:CCGGCCAACTTTCTGACAGAATCTTCTCGAGAAGATTCTGTCAGAAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022777.1-1456s1c1
Sequence:CCGGGCTGAGGCATAAGAATTGTTTCTCGAGAAACAATTCTTATGCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022777.1-328s1c1
Sequence:CCGGGAAGGAAATGGAGATGTGGTACTCGAGTACCACATCTCCATTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022777.1-1077s1c1
Sequence:CCGGCCTTCGTGGAACTCTCCATTTCTCGAGAAATGGAGAGTTCCACGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022777
VALIDATED
RABL5 MISSION shRNA shRNA Plasmid DNA
RAB, member RAS oncogene family-like 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-626s1c1
Sequence:CCGGCCCAGTGAAATCAGCATGTTTCTCGAGAAACATGCTGATTTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-511s1c1
Sequence:CCGGCCGGATGGAATTCATAAAGTACTCGAGTACTTTATGAATTCCATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-451s1c1
Sequence:CCGGGCCACCCTTGAACAAGCTGAACTCGAGTTCAGCTTGTTCAAGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-439s1c1
Sequence:CCGGCCTGTCTTTGTCGCCACCCTTCTCGAGAAGGGTGGCGACAAAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-178s1c1
Sequence:CCGGGCATGTTACCAGCAACAACAACTCGAGTTGTTGTTGCTGGTAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022777.1-237s1c1
Sequence:CCGGGCGATGCTAAGTTTGAGTCCTCTCGAGAGGACTCAAACTTAGCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-178s1c2
Sequence:CCGGGCATGTTACCAGCAACAACAACTCGAGTTGTTGTTGCTGGTAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-395s1c1
Sequence:CCGGCTAATTGCACACCACAAACCACTCGAGTGGTTTGTGGTGTGCAATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-99s1c1
Sequence:CCGGCCAACTTTCTGACAGAATCTTCTCGAGAAGATTCTGTCAGAAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022777.1-1456s1c1
Sequence:CCGGGCTGAGGCATAAGAATTGTTTCTCGAGAAACAATTCTTATGCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022777.1-328s1c1
Sequence:CCGGGAAGGAAATGGAGATGTGGTACTCGAGTACCACATCTCCATTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022777.1-1077s1c1
Sequence:CCGGCCTTCGTGGAACTCTCCATTTCTCGAGAAATGGAGAGTTCCACGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022777
VALIDATED
RABL5 MISSION shRNA Lentiviral Transduction Particles
RAB, member RAS oncogene family-like 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-626s1c1
Sequence:CCGGCCCAGTGAAATCAGCATGTTTCTCGAGAAACATGCTGATTTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-511s1c1
Sequence:CCGGCCGGATGGAATTCATAAAGTACTCGAGTACTTTATGAATTCCATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-451s1c1
Sequence:CCGGGCCACCCTTGAACAAGCTGAACTCGAGTTCAGCTTGTTCAAGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-439s1c1
Sequence:CCGGCCTGTCTTTGTCGCCACCCTTCTCGAGAAGGGTGGCGACAAAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-178s1c1
Sequence:CCGGGCATGTTACCAGCAACAACAACTCGAGTTGTTGTTGCTGGTAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022777.1-237s1c1
Sequence:CCGGGCGATGCTAAGTTTGAGTCCTCTCGAGAGGACTCAAACTTAGCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-178s1c2
Sequence:CCGGGCATGTTACCAGCAACAACAACTCGAGTTGTTGTTGCTGGTAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022777.1-395s1c1
Sequence:CCGGCTAATTGCACACCACAAACCACTCGAGTGGTTTGTGGTGTGCAATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022777.1-99s1c1
Sequence:CCGGCCAACTTTCTGACAGAATCTTCTCGAGAAGATTCTGTCAGAAAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022777.1-1456s1c1
Sequence:CCGGGCTGAGGCATAAGAATTGTTTCTCGAGAAACAATTCTTATGCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022777.1-328s1c1
Sequence:CCGGGAAGGAAATGGAGATGTGGTACTCGAGTACCACATCTCCATTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022777.1-1077s1c1
Sequence:CCGGCCTTCGTGGAACTCTCCATTTCTCGAGAAATGGAGAGTTCCACGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)