EMAIL THIS PAGE TO A FRIEND

RABL6

RAB, member RAS oncogene family-like 6

72 Gene Product Result for
Synonyms: C9orf86 PARF RBEL1 pp8875
Gene ID:
Human(55684) Summary: This gene encodes a member of the Ras superfamily of small GTPases. The encoded protein binds to both GTP and GDP and may play a role in cell growth and survival. Overexpression of this gene may play a role in breast cancer tumorigenesis, and pseudogenes of this gene are located on the long arm of chromosome 2 and the short arm of chromosome 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(227624) RAB, member of RAS oncogene family-like 6
Rat(362084) RAB, member RAS oncogene family-like 6
Zebrafish(572091) RAB, member RAS oncogene family-like 6
chicken(417284) RAB, member RAS oncogene family-like 6
dog(480675) RAB, member RAS oncogene family-like 6
domestic cat(101095866) RAB, member RAS oncogene family-like 6
cow(508218) RAB, member RAS oncogene family-like 6
sheep(101105737) RAB, member RAS oncogene family-like 6
domestic guinea pig(100733990) RAB, member RAS oncogene family-like 6
naked mole-rat(101711527) RAB, member RAS oncogene family-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203161 MISSION® esiRNA esiRNA targeting mouse B230208H17Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017995 Rosetta Predictions human pricing
NM_024718 Rosetta Predictions human pricing
NM_001108573 Rosetta Predictions rat pricing
NM_001024616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351048 predicted 922
2 SASI_Hs02_00351049 predicted 657
3 SASI_Hs02_00351050 predicted 881
4 SASI_Hs02_00351051 predicted 1822
5 SASI_Hs02_00351052 predicted 1689
6 SASI_Hs02_00351053 predicted 886
7 SASI_Hs02_00351054 predicted 537
8 SASI_Hs02_00351055 predicted 689
9 SASI_Hs02_00351056 predicted 509
10 SASI_Hs02_00351057 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357178 predicted 915
2 SASI_Hs02_00357179 predicted 650
3 SASI_Hs01_00123101 predicted 873
4 SASI_Hs01_00123103 predicted 2890
5 SASI_Hs01_00123104 predicted 889
6 SASI_Hs02_00357180 predicted 529
7 SASI_Hs02_00357181 predicted 694
8 SASI_Hs01_00123108 predicted 505
9 SASI_Hs02_00357182 predicted 869
10 SASI_Hs02_00357183 predicted 605
11 SASI_Hs01_00123099 predicted 1961
12 SASI_Hs01_00123100 predicted 1756
13 SASI_Hs01_00123102 predicted 1442
14 SASI_Hs01_00123105 predicted 530
15 SASI_Hs01_00123106 predicted 546
16 SASI_Hs01_00123107 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239969 predicted 662
2 SASI_Rn02_00239970 predicted 670
3 SASI_Rn02_00239971 predicted 363
4 SASI_Rn02_00239972 predicted 647
5 SASI_Rn02_00239973 predicted 1578
6 SASI_Rn02_00239974 predicted 1315
7 SASI_Rn02_00239975 predicted 1364
8 SASI_Rn02_00239976 predicted 1733
9 SASI_Rn02_00239977 predicted 405
10 SASI_Rn02_00239978 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088373 predicted 959
2 SASI_Mm01_00088374 predicted 505
3 SASI_Mm01_00088375 predicted 619
4 SASI_Mm01_00088376 predicted 1913
5 SASI_Mm01_00088377 predicted 852
6 SASI_Mm01_00088378 predicted 1565
7 SASI_Mm01_00088379 predicted 598
8 SASI_Mm02_00287629 predicted 500
9 SASI_Mm01_00088381 predicted 868
10 SASI_Mm01_00088382 predicted 857
11 SASI_Mm01_00088380 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024718
VALIDATED
RABL6 MISSION shRNA Bacterial Glycerol Stock
RAB, member RAS oncogene family-like 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-2911s21c1
Sequence:CCGGGTGTGCAGACTCACCCTAAAGCTCGAGCTTTAGGGTGAGTCTGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-922s21c1
Sequence:CCGGCGGCCTAAAGTACCTTCATAACTCGAGTTATGAAGGTACTTTAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024718.3-1942s21c1
Sequence:CCGGGGGACCCATTGCTGCACAAATCTCGAGATTTGTGCAGCAATGGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-696s21c1
Sequence:CCGGTGGTCATGATGTTCGACATTACTCGAGTAATGTCGAACATCATGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-2131s21c1
Sequence:CCGGGAAGAATGACTCGGACCTCTTCTCGAGAAGAGGTCCGAGTCATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-2732s1c1
Sequence:CCGGCCGCCAGTGTTTCTCAGGGATCTCGAGATCCCTGAGAAACACTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-929s1c1
Sequence:CCGGCGGCCTAAAGTACCTTCATAACTCGAGTTATGAAGGTACTTTAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024718.2-728s1c1
Sequence:CCGGGCAGTGGACCTTCAATTACATCTCGAGATGTAATTGAAGGTCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024718.2-1663s1c1
Sequence:CCGGCCAGTCAAGACATCACTCTTTCTCGAGAAAGAGTGATGTCTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-2138s1c1
Sequence:CCGGGAAGAATGACTCGGACCTCTTCTCGAGAAGAGGTCCGAGTCATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024718
VALIDATED
RABL6 MISSION shRNA shRNA Plasmid DNA
RAB, member RAS oncogene family-like 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-2911s21c1
Sequence:CCGGGTGTGCAGACTCACCCTAAAGCTCGAGCTTTAGGGTGAGTCTGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-922s21c1
Sequence:CCGGCGGCCTAAAGTACCTTCATAACTCGAGTTATGAAGGTACTTTAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024718.3-1942s21c1
Sequence:CCGGGGGACCCATTGCTGCACAAATCTCGAGATTTGTGCAGCAATGGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-696s21c1
Sequence:CCGGTGGTCATGATGTTCGACATTACTCGAGTAATGTCGAACATCATGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-2131s21c1
Sequence:CCGGGAAGAATGACTCGGACCTCTTCTCGAGAAGAGGTCCGAGTCATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-2732s1c1
Sequence:CCGGCCGCCAGTGTTTCTCAGGGATCTCGAGATCCCTGAGAAACACTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-929s1c1
Sequence:CCGGCGGCCTAAAGTACCTTCATAACTCGAGTTATGAAGGTACTTTAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024718.2-728s1c1
Sequence:CCGGGCAGTGGACCTTCAATTACATCTCGAGATGTAATTGAAGGTCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024718.2-1663s1c1
Sequence:CCGGCCAGTCAAGACATCACTCTTTCTCGAGAAAGAGTGATGTCTTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-2138s1c1
Sequence:CCGGGAAGAATGACTCGGACCTCTTCTCGAGAAGAGGTCCGAGTCATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024718
VALIDATED
RABL6 MISSION shRNA Lentiviral Transduction Particles
RAB, member RAS oncogene family-like 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-2911s21c1
Sequence:CCGGGTGTGCAGACTCACCCTAAAGCTCGAGCTTTAGGGTGAGTCTGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-922s21c1
Sequence:CCGGCGGCCTAAAGTACCTTCATAACTCGAGTTATGAAGGTACTTTAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024718.3-1942s21c1
Sequence:CCGGGGGACCCATTGCTGCACAAATCTCGAGATTTGTGCAGCAATGGGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-696s21c1
Sequence:CCGGTGGTCATGATGTTCGACATTACTCGAGTAATGTCGAACATCATGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024718.3-2131s21c1
Sequence:CCGGGAAGAATGACTCGGACCTCTTCTCGAGAAGAGGTCCGAGTCATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-2732s1c1
Sequence:CCGGCCGCCAGTGTTTCTCAGGGATCTCGAGATCCCTGAGAAACACTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-929s1c1
Sequence:CCGGCGGCCTAAAGTACCTTCATAACTCGAGTTATGAAGGTACTTTAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024718.2-728s1c1
Sequence:CCGGGCAGTGGACCTTCAATTACATCTCGAGATGTAATTGAAGGTCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024718.2-1663s1c1
Sequence:CCGGCCAGTCAAGACATCACTCTTTCTCGAGAAAGAGTGATGTCTTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024718.2-2138s1c1
Sequence:CCGGGAAGAATGACTCGGACCTCTTCTCGAGAAGAGGTCCGAGTCATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024616
VALIDATED
RABL6 MISSION shRNA Bacterial Glycerol Stock
RAB, member RAS oncogene family-like 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024616.1-2384s21c1
Sequence:CCGGCATGCCTAGGGCAATTGATTGCTCGAGCAATCAATTGCCCTAGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-654s21c1
Sequence:CCGGTAAGCAGTGGACCTTCAATTACTCGAGTAATTGAAGGTCCACTGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-1707s21c1
Sequence:CCGGCTCAGAGCCTGAGACTAAATGCTCGAGCATTTAGTCTCAGGCTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024616.1-508s21c1
Sequence:CCGGGTTGACAAAGGAAAGTGTAAACTCGAGTTTACACTTTCCTTTGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-1307s21c1
Sequence:CCGGGTATCATCTCTCGGCTGTTTGCTCGAGCAAACAGCCGAGAGATGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024616
VALIDATED
RABL6 MISSION shRNA shRNA Plasmid DNA
RAB, member RAS oncogene family-like 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024616.1-2384s21c1
Sequence:CCGGCATGCCTAGGGCAATTGATTGCTCGAGCAATCAATTGCCCTAGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-654s21c1
Sequence:CCGGTAAGCAGTGGACCTTCAATTACTCGAGTAATTGAAGGTCCACTGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-1707s21c1
Sequence:CCGGCTCAGAGCCTGAGACTAAATGCTCGAGCATTTAGTCTCAGGCTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024616.1-508s21c1
Sequence:CCGGGTTGACAAAGGAAAGTGTAAACTCGAGTTTACACTTTCCTTTGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-1307s21c1
Sequence:CCGGGTATCATCTCTCGGCTGTTTGCTCGAGCAAACAGCCGAGAGATGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024616
VALIDATED
RABL6 MISSION shRNA Lentiviral Transduction Particles
RAB, member RAS oncogene family-like 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024616.1-2384s21c1
Sequence:CCGGCATGCCTAGGGCAATTGATTGCTCGAGCAATCAATTGCCCTAGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-654s21c1
Sequence:CCGGTAAGCAGTGGACCTTCAATTACTCGAGTAATTGAAGGTCCACTGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-1707s21c1
Sequence:CCGGCTCAGAGCCTGAGACTAAATGCTCGAGCATTTAGTCTCAGGCTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024616.1-508s21c1
Sequence:CCGGGTTGACAAAGGAAAGTGTAAACTCGAGTTTACACTTTCCTTTGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024616.1-1307s21c1
Sequence:CCGGGTATCATCTCTCGGCTGTTTGCTCGAGCAAACAGCCGAGAGATGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)