EMAIL THIS PAGE TO A FRIEND

RAC2

ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)

49 Gene Product Result for
Synonyms: EN-7 Gx HSPC022 p21-Rac2
UniProtKB ID: P15153, Q9UDJ4
Gene ID:
Human(5880) Summary: This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
Mouse(19354) RAS-related C3 botulinum substrate 2
Rat(366957) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
fruit fly(38831) CG8556 gene product from transcript CG8556-RB
domestic cat(101096744) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
dog(481271) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
chicken(418044) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Zebrafish(415151) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Thale Cress(834637) Rac-like GTP-binding protein ARAC2
domestic guinea pig(100731468) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
naked mole-rat(101725000) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
cow(327671) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
sheep(101107592) ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002872 Rosetta Predictions human pricing
NM_001008384 Rosetta Predictions rat pricing
NM_009008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247211 predicted 230
2 SASI_Hs01_00247212 predicted 363
3 SASI_Hs01_00247213 predicted 713
4 SASI_Hs01_00247214 predicted 553
5 SASI_Hs01_00247215 predicted 738
6 SASI_Hs01_00247216 predicted 549
7 SASI_Hs01_00247217 predicted 233
8 SASI_Hs01_00247218 predicted 217
9 SASI_Hs01_00247219 predicted 340
10 SASI_Hs01_00247220 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086991 predicted 579
2 SASI_Rn02_00199160 predicted 211
3 SASI_Rn01_00086992 predicted 914
4 SASI_Rn02_00199161 predicted 531
5 SASI_Rn01_00086994 predicted 1002
6 SASI_Rn01_00086996 predicted 841
7 SASI_Rn01_00086997 predicted 808
8 SASI_Rn01_00086998 predicted 732
9 SASI_Rn01_00086999 predicted 722
10 SASI_Rn01_00087000 predicted 547
11 SASI_Rn01_00086993 predicted 531
12 SASI_Rn01_00086995 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315140 predicted 254
2 SASI_Mm02_00315141 predicted 1203
3 SASI_Mm02_00315142 predicted 574
4 SASI_Mm02_00315143 predicted 1036
5 SASI_Mm02_00315144 predicted 1135
6 SASI_Mm02_00315145 predicted 422
7 SASI_Mm02_00315146 predicted 343
8 SASI_Mm02_00315147 predicted 819
9 SASI_Mm02_00315148 predicted 592
10 SASI_Mm02_00315149 predicted 1037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002872
VALIDATED
RAC2 MISSION shRNA Bacterial Glycerol Stock
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-218s21c1
Sequence:CCGGCCACCGTGTTTGACAACTATTCTCGAGAATAGTTGTCAAACACGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-557s21c1
Sequence:CCGGAGGAGATTGACTCGGTGAAATCTCGAGATTTCACCGAGTCAATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-174s21c1
Sequence:CCGGTCTCATCAGCTACACCACCAACTCGAGTTGGTGGTGTAGCTGATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002872.3-1361s21c1
Sequence:CCGGCCTGTGAGAGTCTTCAAACTTCTCGAGAAGTTTGAAGACTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-174s1c1
Sequence:CCGGTCTCATCAGCTACACCACCAACTCGAGTTGGTGGTGTAGCTGATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002872.3-557s1c1
Sequence:CCGGAGGAGATTGACTCGGTGAAATCTCGAGATTTCACCGAGTCAATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-218s1c1
Sequence:CCGGCCACCGTGTTTGACAACTATTCTCGAGAATAGTTGTCAAACACGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002872.3-1361s1c1
Sequence:CCGGCCTGTGAGAGTCTTCAAACTTCTCGAGAAGTTTGAAGACTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-481s1c1
Sequence:CCGGGACAAGGACACCATCGAGAAACTCGAGTTTCTCGATGGTGTCCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-481s21c1
Sequence:CCGGGACAAGGACACCATCGAGAAACTCGAGTTTCTCGATGGTGTCCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002872
VALIDATED
RAC2 MISSION shRNA shRNA Plasmid DNA
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-218s21c1
Sequence:CCGGCCACCGTGTTTGACAACTATTCTCGAGAATAGTTGTCAAACACGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-557s21c1
Sequence:CCGGAGGAGATTGACTCGGTGAAATCTCGAGATTTCACCGAGTCAATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-174s21c1
Sequence:CCGGTCTCATCAGCTACACCACCAACTCGAGTTGGTGGTGTAGCTGATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002872.3-1361s21c1
Sequence:CCGGCCTGTGAGAGTCTTCAAACTTCTCGAGAAGTTTGAAGACTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-174s1c1
Sequence:CCGGTCTCATCAGCTACACCACCAACTCGAGTTGGTGGTGTAGCTGATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002872.3-557s1c1
Sequence:CCGGAGGAGATTGACTCGGTGAAATCTCGAGATTTCACCGAGTCAATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-218s1c1
Sequence:CCGGCCACCGTGTTTGACAACTATTCTCGAGAATAGTTGTCAAACACGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002872.3-1361s1c1
Sequence:CCGGCCTGTGAGAGTCTTCAAACTTCTCGAGAAGTTTGAAGACTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-481s1c1
Sequence:CCGGGACAAGGACACCATCGAGAAACTCGAGTTTCTCGATGGTGTCCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-481s21c1
Sequence:CCGGGACAAGGACACCATCGAGAAACTCGAGTTTCTCGATGGTGTCCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002872
VALIDATED
RAC2 MISSION shRNA Lentiviral Transduction Particles
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-218s21c1
Sequence:CCGGCCACCGTGTTTGACAACTATTCTCGAGAATAGTTGTCAAACACGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-557s21c1
Sequence:CCGGAGGAGATTGACTCGGTGAAATCTCGAGATTTCACCGAGTCAATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-174s21c1
Sequence:CCGGTCTCATCAGCTACACCACCAACTCGAGTTGGTGGTGTAGCTGATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002872.3-1361s21c1
Sequence:CCGGCCTGTGAGAGTCTTCAAACTTCTCGAGAAGTTTGAAGACTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-174s1c1
Sequence:CCGGTCTCATCAGCTACACCACCAACTCGAGTTGGTGGTGTAGCTGATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002872.3-557s1c1
Sequence:CCGGAGGAGATTGACTCGGTGAAATCTCGAGATTTCACCGAGTCAATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-218s1c1
Sequence:CCGGCCACCGTGTTTGACAACTATTCTCGAGAATAGTTGTCAAACACGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002872.3-1361s1c1
Sequence:CCGGCCTGTGAGAGTCTTCAAACTTCTCGAGAAGTTTGAAGACTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002872.3-481s1c1
Sequence:CCGGGACAAGGACACCATCGAGAAACTCGAGTTTCTCGATGGTGTCCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002872.3-481s21c1
Sequence:CCGGGACAAGGACACCATCGAGAAACTCGAGTTTCTCGATGGTGTCCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009008
RAC2 MISSION shRNA Bacterial Glycerol Stock
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-266s1c1
Sequence:CCGGCCTACCCACAGACAGATGTATCTCGAGATACATCTGTCTGTGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-179s1c1
Sequence:CCGGCCAATGTGATGGTGGACAGTACTCGAGTACTGTCCACCATCACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-337s1c1
Sequence:CCGGGCCAAGTGGTTCCCTGAGGTACTCGAGTACCTCAGGGAACCACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-492s1c1
Sequence:CCGGCAAGGATATTGATTCAGTCAACTCGAGTTGACTGAATCAATATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-502s1c1
Sequence:CCGGGATTCAGTCAAGTACTTGGAACTCGAGTTCCAAGTACTTGACTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009008
RAC2 MISSION shRNA shRNA Plasmid DNA
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-266s1c1
Sequence:CCGGCCTACCCACAGACAGATGTATCTCGAGATACATCTGTCTGTGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-179s1c1
Sequence:CCGGCCAATGTGATGGTGGACAGTACTCGAGTACTGTCCACCATCACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-337s1c1
Sequence:CCGGGCCAAGTGGTTCCCTGAGGTACTCGAGTACCTCAGGGAACCACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-492s1c1
Sequence:CCGGCAAGGATATTGATTCAGTCAACTCGAGTTGACTGAATCAATATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-502s1c1
Sequence:CCGGGATTCAGTCAAGTACTTGGAACTCGAGTTCCAAGTACTTGACTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009008
RAC2 MISSION shRNA Lentiviral Transduction Particles
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-266s1c1
Sequence:CCGGCCTACCCACAGACAGATGTATCTCGAGATACATCTGTCTGTGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-179s1c1
Sequence:CCGGCCAATGTGATGGTGGACAGTACTCGAGTACTGTCCACCATCACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-337s1c1
Sequence:CCGGGCCAAGTGGTTCCCTGAGGTACTCGAGTACCTCAGGGAACCACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-492s1c1
Sequence:CCGGCAAGGATATTGATTCAGTCAACTCGAGTTGACTGAATCAATATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009008.2-502s1c1
Sequence:CCGGGATTCAGTCAAGTACTTGGAACTCGAGTTCCAAGTACTTGACTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)