EMAIL THIS PAGE TO A FRIEND

RAC3

ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)

43 Gene Product Result for
UniProtKB ID: P60763, O14658, Q5U0M8
Gene ID:
Human(5881) Summary: The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. [provided by RefSeq, Jul 2008]
Mouse(170758) RAS-related C3 botulinum substrate 3
Rat(688319) ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
cow(619066) ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
naked mole-rat(101723777) ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
domestic guinea pig(100736181) ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Thale Cress(829654) Rac-like GTP-binding protein ARAC3
domestic cat(101080496) ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
dog(100687951) ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
chicken(395870) ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU082921 MISSION® esiRNA esiRNA targeting mouse Rac3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005052 Rosetta Predictions human pricing
XM_001081814 Rosetta Predictions rat pricing
NM_133223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112423 predicted 541
2 SASI_Hs01_00112424 predicted 547
3 SASI_Hs01_00112425 predicted 541
4 SASI_Hs02_00338862 predicted 542
5 SASI_Hs01_00112426 predicted 542
6 SASI_Hs01_00112429 predicted 363
7 SASI_Hs01_00112430 predicted 353
8 SASI_Hs01_00112431 predicted 536
9 SASI_Hs01_00112432 predicted 318
10 SASI_Hs02_00338863 predicted 326
11 SASI_Hs01_00112427 predicted 530
12 SASI_Hs01_00112428 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373602 predicted 287
2 SASI_Rn02_00373603 predicted 265
3 SASI_Rn02_00373604 predicted 341
4 SASI_Rn02_00373605 predicted 299
5 SASI_Rn02_00373606 predicted 293
6 SASI_Rn02_00373607 predicted 210
7 SASI_Rn02_00373608 predicted 349
8 SASI_Rn02_00373609 predicted 357
9 SASI_Rn02_00373610 predicted 362
10 SASI_Rn02_00373611 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101336 predicted 757
2 SASI_Mm01_00101337 predicted 569
3 SASI_Mm01_00101338 predicted 765
4 SASI_Mm01_00101339 predicted 614
5 SASI_Mm01_00101340 predicted 577
6 SASI_Mm01_00101341 predicted 693
7 SASI_Mm01_00101342 predicted 506
8 SASI_Mm01_00101343 predicted 700
9 SASI_Mm02_00338455 predicted 379
10 SASI_Mm01_00101344 predicted 745
11 SASI_Mm01_00101345 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005052
VALIDATED
RAC3 MISSION shRNA Bacterial Glycerol Stock
ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-220s21c1
Sequence:CCGGCAACTACTCTGCCAACGTGATCTCGAGATCACGTTGGCAGAGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-544s1c1
Sequence:CCGGCCGGGAGATTGGCTCTGTGAACTCGAGTTCACAGAGCCAATCTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-373s1c1
Sequence:CCGGCTTCGAGAATGTTCGTGCCAACTCGAGTTGGCACGAACATTCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005052.2-220s1c1
Sequence:CCGGCAACTACTCTGCCAACGTGATCTCGAGATCACGTTGGCAGAGTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-331s1c1
Sequence:CCGGTGACGTCTTTCTGATCTGCTTCTCGAGAAGCAGATCAGAAAGACGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-664s1c1
Sequence:CCGGGAAGAAGTGCACCGTCTTCTACTCGAGTAGAAGACGGTGCACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-331s21c1
Sequence:CCGGTGACGTCTTTCTGATCTGCTTCTCGAGAAGCAGATCAGAAAGACGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-544s21c1
Sequence:CCGGCCGGGAGATTGGCTCTGTGAACTCGAGTTCACAGAGCCAATCTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-664s21c1
Sequence:CCGGGAAGAAGTGCACCGTCTTCTACTCGAGTAGAAGACGGTGCACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005052
VALIDATED
RAC3 MISSION shRNA shRNA Plasmid DNA
ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-220s21c1
Sequence:CCGGCAACTACTCTGCCAACGTGATCTCGAGATCACGTTGGCAGAGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-544s1c1
Sequence:CCGGCCGGGAGATTGGCTCTGTGAACTCGAGTTCACAGAGCCAATCTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-373s1c1
Sequence:CCGGCTTCGAGAATGTTCGTGCCAACTCGAGTTGGCACGAACATTCTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005052.2-220s1c1
Sequence:CCGGCAACTACTCTGCCAACGTGATCTCGAGATCACGTTGGCAGAGTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-331s1c1
Sequence:CCGGTGACGTCTTTCTGATCTGCTTCTCGAGAAGCAGATCAGAAAGACGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-664s1c1
Sequence:CCGGGAAGAAGTGCACCGTCTTCTACTCGAGTAGAAGACGGTGCACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-331s21c1
Sequence:CCGGTGACGTCTTTCTGATCTGCTTCTCGAGAAGCAGATCAGAAAGACGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-544s21c1
Sequence:CCGGCCGGGAGATTGGCTCTGTGAACTCGAGTTCACAGAGCCAATCTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-664s21c1
Sequence:CCGGGAAGAAGTGCACCGTCTTCTACTCGAGTAGAAGACGGTGCACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005052
VALIDATED
RAC3 MISSION shRNA Lentiviral Transduction Particles
ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-220s21c1
Sequence:CCGGCAACTACTCTGCCAACGTGATCTCGAGATCACGTTGGCAGAGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-544s1c1
Sequence:CCGGCCGGGAGATTGGCTCTGTGAACTCGAGTTCACAGAGCCAATCTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-373s1c1
Sequence:CCGGCTTCGAGAATGTTCGTGCCAACTCGAGTTGGCACGAACATTCTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005052.2-220s1c1
Sequence:CCGGCAACTACTCTGCCAACGTGATCTCGAGATCACGTTGGCAGAGTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-331s1c1
Sequence:CCGGTGACGTCTTTCTGATCTGCTTCTCGAGAAGCAGATCAGAAAGACGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005052.2-664s1c1
Sequence:CCGGGAAGAAGTGCACCGTCTTCTACTCGAGTAGAAGACGGTGCACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-331s21c1
Sequence:CCGGTGACGTCTTTCTGATCTGCTTCTCGAGAAGCAGATCAGAAAGACGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-544s21c1
Sequence:CCGGCCGGGAGATTGGCTCTGTGAACTCGAGTTCACAGAGCCAATCTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005052.2-664s21c1
Sequence:CCGGGAAGAAGTGCACCGTCTTCTACTCGAGTAGAAGACGGTGCACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133223
RAC3 MISSION shRNA Bacterial Glycerol Stock
ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-498s1c1
Sequence:CCGGCGTGATGACAAGGATACGATTCTCGAGAATCGTATCCTTGTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-695s1c1
Sequence:CCGGAGGCAAGAAGTGCACTGTATTCTCGAGAATACAGTGCACTTCTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-581s1c1
Sequence:CCGGAGAGATTGGTTCCGTCAAGTACTCGAGTACTTGACGGAACCAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-348s1c1
Sequence:CCGGCTCTCCTATCCTCAAACAGATCTCGAGATCTGTTTGAGGATAGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-359s1c1
Sequence:CCGGTCAAACAGATGTCTTTCTGATCTCGAGATCAGAAAGACATCTGTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133223
RAC3 MISSION shRNA shRNA Plasmid DNA
ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-498s1c1
Sequence:CCGGCGTGATGACAAGGATACGATTCTCGAGAATCGTATCCTTGTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-695s1c1
Sequence:CCGGAGGCAAGAAGTGCACTGTATTCTCGAGAATACAGTGCACTTCTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-581s1c1
Sequence:CCGGAGAGATTGGTTCCGTCAAGTACTCGAGTACTTGACGGAACCAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-348s1c1
Sequence:CCGGCTCTCCTATCCTCAAACAGATCTCGAGATCTGTTTGAGGATAGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-359s1c1
Sequence:CCGGTCAAACAGATGTCTTTCTGATCTCGAGATCAGAAAGACATCTGTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133223
RAC3 MISSION shRNA Lentiviral Transduction Particles
ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-498s1c1
Sequence:CCGGCGTGATGACAAGGATACGATTCTCGAGAATCGTATCCTTGTCATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-695s1c1
Sequence:CCGGAGGCAAGAAGTGCACTGTATTCTCGAGAATACAGTGCACTTCTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-581s1c1
Sequence:CCGGAGAGATTGGTTCCGTCAAGTACTCGAGTACTTGACGGAACCAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-348s1c1
Sequence:CCGGCTCTCCTATCCTCAAACAGATCTCGAGATCTGTTTGAGGATAGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133223.2-359s1c1
Sequence:CCGGTCAAACAGATGTCTTTCTGATCTCGAGATCAGAAAGACATCTGTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)