EMAIL THIS PAGE TO A FRIEND

RACGAP1

Rac GTPase activating protein 1

111 Gene Product Result for
Synonyms: CYK4 HsCYK-4 ID-GAP MgcRacGAP
UniProtKB ID: Q9H0H5, Q6PJ26, Q9NWN2, Q9P250, Q9P2W2
Gene ID:
Human(29127) Summary: The protein encoded by this gene belongs to the GTPase-activating protein (GAP) family. GAPs bind activated forms of Rho GTPases and stimulate GTP hydrolysis. Through this catalytic function, GAPs negatively regulate Rho-mediated signals. This protein plays a regulatory role in initiation of cytokinesis, controlling cell growth and differentiation of hematopoietic cells, regulating spermatogenesis, and in neuronal proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(26934) Rac GTPase-activating protein 1
Rat(315298) Rac GTPase-activating protein 1
Zebrafish(323197) Rac GTPase-activating protein 1
Horse(100059818) Rac GTPase activating protein 1
domestic cat(101085475) Rac GTPase activating protein 1
dog(486549) Rac GTPase activating protein 1
chicken(426884) Rac GTPase activating protein 1
domestic guinea pig(100721177) Rac GTPase activating protein 1
naked mole-rat(101704773) Rac GTPase activating protein 1
Domestic Rabbit(100354099) Rac GTPase activating protein 1
cow(514618) Rac GTPase activating protein 1
sheep(101120998) Rac GTPase activating protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013277 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081301 MISSION® esiRNA esiRNA human RACGAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126103 Rosetta Predictions human pricing
NM_001126104 Rosetta Predictions human pricing
NM_013277 Rosetta Predictions human pricing
NM_001108112 Rosetta Predictions rat pricing
NM_012025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328137 predicted 745
2 SASI_Hs02_00328138 predicted 741
3 SASI_Hs02_00328139 predicted 624
4 SASI_Hs02_00328140 predicted 1843
5 SASI_Hs02_00328141 predicted 557
6 SASI_Hs02_00328142 predicted 1407
7 SASI_Hs02_00328143 predicted 1618
8 SASI_Hs02_00328144 predicted 617
9 SASI_Hs02_00328145 predicted 541
10 SASI_Hs02_00328146 predicted 2221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328147 predicted 623
2 SASI_Hs02_00328148 predicted 620
3 SASI_Hs02_00328149 predicted 507
4 SASI_Hs02_00328150 predicted 1722
5 SASI_Hs02_00328151 predicted 435
6 SASI_Hs02_00328152 predicted 1283
7 SASI_Hs02_00328153 predicted 1502
8 SASI_Hs02_00328154 predicted 501
9 SASI_Hs02_00328155 predicted 420
10 SASI_Hs02_00328156 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344522 predicted 727
2 SASI_Hs02_00344523 predicted 729
3 SASI_Hs01_00195553 predicted 613
4 SASI_Hs01_00195556 predicted 1830
5 SASI_Hs02_00344524 predicted 553
6 SASI_Hs01_00195560 predicted 1393
7 SASI_Hs02_00344525 predicted 1603
8 SASI_Hs01_00195561 predicted 606
9 SASI_Hs02_00344526 predicted 533
10 SASI_Hs02_00344527 predicted 2204
11 SASI_Hs01_00195554 predicted 698
12 SASI_Hs01_00195555 predicted 709
13 SASI_Hs01_00195557 predicted 2038
14 SASI_Hs01_00195558 predicted 555
15 SASI_Hs01_00195559 predicted 1977
16 SASI_Hs01_00195562 predicted 2066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235474 predicted 919
2 SASI_Rn02_00235475 predicted 262
3 SASI_Rn02_00235476 predicted 486
4 SASI_Rn02_00235477 predicted 649
5 SASI_Rn02_00235478 predicted 1916
6 SASI_Rn02_00235479 predicted 477
7 SASI_Rn02_00235480 predicted 669
8 SASI_Rn02_00235481 predicted 1784
9 SASI_Rn02_00235482 predicted 886
10 SASI_Rn02_00235483 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321983 predicted 263
2 SASI_Mm02_00321984 predicted 478
3 SASI_Mm02_00321985 predicted 1739
4 SASI_Mm02_00321986 predicted 550
5 SASI_Mm02_00321987 predicted 1616
6 SASI_Mm02_00321988 predicted 787
7 SASI_Mm02_00321989 predicted 1860
8 SASI_Mm02_00321990 predicted 1713
9 SASI_Mm02_00321991 predicted 1754
10 SASI_Mm02_00321992 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012025
VALIDATED
RACGAP1 MISSION shRNA Bacterial Glycerol Stock
Rac GTPase activating protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-2020s21c1
Sequence:CCGGCCTGTCACAGAGGTTGTACAACTCGAGTTGTACAACCTCTGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-370s21c1
Sequence:CCGGCTTCCGAAAGAAGTATCAAAGCTCGAGCTTTGATACTTCTTTCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-1120s21c1
Sequence:CCGGCGTCTCAAAGACGGTTATTAACTCGAGTTAATAACCGTCTTTGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-2022s1c1
Sequence:CCGGCCTGTCACAGAGGTTGTACAACTCGAGTTGTACAACCTCTGTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012025.3-301s1c1
Sequence:CCGGCGCCGGATGGAGATTATCAATCTCGAGATTGATAATCTCCATCCGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012025.3-668s1c1
Sequence:CCGGCCGGCAACAATAGACTGTCAACTCGAGTTGACAGTCTATTGTTGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-941s1c1
Sequence:CCGGCCATTGAAGCTGTGTCTACTACTCGAGTAGTAGACACAGCTTCAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-1122s1c1
Sequence:CCGGCGTCTCAAAGACGGTTATTAACTCGAGTTAATAACCGTCTTTGAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-2470s21c1
Sequence:CCGGACCTCTTAGGTAACGTCTTAGCTCGAGCTAAGACGTTACCTAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-465s21c1
Sequence:CCGGAGCTGAAGCATGCCCGTAATCCTCGAGGATTACGGGCATGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012025
VALIDATED
RACGAP1 MISSION shRNA shRNA Plasmid DNA
Rac GTPase activating protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-2020s21c1
Sequence:CCGGCCTGTCACAGAGGTTGTACAACTCGAGTTGTACAACCTCTGTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-370s21c1
Sequence:CCGGCTTCCGAAAGAAGTATCAAAGCTCGAGCTTTGATACTTCTTTCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-1120s21c1
Sequence:CCGGCGTCTCAAAGACGGTTATTAACTCGAGTTAATAACCGTCTTTGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-2022s1c1
Sequence:CCGGCCTGTCACAGAGGTTGTACAACTCGAGTTGTACAACCTCTGTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012025.3-301s1c1
Sequence:CCGGCGCCGGATGGAGATTATCAATCTCGAGATTGATAATCTCCATCCGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012025.3-668s1c1
Sequence:CCGGCCGGCAACAATAGACTGTCAACTCGAGTTGACAGTCTATTGTTGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-941s1c1
Sequence:CCGGCCATTGAAGCTGTGTCTACTACTCGAGTAGTAGACACAGCTTCAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-1122s1c1
Sequence:CCGGCGTCTCAAAGACGGTTATTAACTCGAGTTAATAACCGTCTTTGAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-2470s21c1
Sequence:CCGGACCTCTTAGGTAACGTCTTAGCTCGAGCTAAGACGTTACCTAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-465s21c1
Sequence:CCGGAGCTGAAGCATGCCCGTAATCCTCGAGGATTACGGGCATGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012025
VALIDATED
RACGAP1 MISSION shRNA Lentiviral Transduction Particles
Rac GTPase activating protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-2020s21c1
Sequence:CCGGCCTGTCACAGAGGTTGTACAACTCGAGTTGTACAACCTCTGTGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-370s21c1
Sequence:CCGGCTTCCGAAAGAAGTATCAAAGCTCGAGCTTTGATACTTCTTTCGGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-1120s21c1
Sequence:CCGGCGTCTCAAAGACGGTTATTAACTCGAGTTAATAACCGTCTTTGAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-2022s1c1
Sequence:CCGGCCTGTCACAGAGGTTGTACAACTCGAGTTGTACAACCTCTGTGACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012025.3-301s1c1
Sequence:CCGGCGCCGGATGGAGATTATCAATCTCGAGATTGATAATCTCCATCCGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012025.3-668s1c1
Sequence:CCGGCCGGCAACAATAGACTGTCAACTCGAGTTGACAGTCTATTGTTGCCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-941s1c1
Sequence:CCGGCCATTGAAGCTGTGTCTACTACTCGAGTAGTAGACACAGCTTCAATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012025.3-1122s1c1
Sequence:CCGGCGTCTCAAAGACGGTTATTAACTCGAGTTAATAACCGTCTTTGAGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-2470s21c1
Sequence:CCGGACCTCTTAGGTAACGTCTTAGCTCGAGCTAAGACGTTACCTAAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_012025.6-465s21c1
Sequence:CCGGAGCTGAAGCATGCCCGTAATCCTCGAGGATTACGGGCATGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013277
VALIDATED
RACGAP1 MISSION shRNA Bacterial Glycerol Stock
Rac GTPase activating protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-2165s21c1
Sequence:CCGGCTAGGACGACAAGGCAACTTTCTCGAGAAAGTTGCCTTGTCGTCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-1161s21c1
Sequence:CCGGTGCGCCTGCATGACTTTGTTTCTCGAGAAACAAAGTCATGCAGGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013277.3-542s21c1
Sequence:CCGGCAGGTGGATGTAGAGATCAAACTCGAGTTTGATCTCTACATCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-362s21c1
Sequence:CCGGCGGGTGGAGATTCTCAGTGAACTCGAGTTCACTGAGAATCTCCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-276s1c1
Sequence:CCGGCGGGTGGAGATTCTCAGTGAACTCGAGTTCACTGAGAATCTCCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-659s1c1
Sequence:CCGGCATTGATGAATCTGGTTCCATCTCGAGATGGAACCAGATTCATCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013277.2-1075s1c1
Sequence:CCGGTGCGCCTGCATGACTTTGTTTCTCGAGAAACAAAGTCATGCAGGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013277.2-2079s1c1
Sequence:CCGGCTAGGACGACAAGGCAACTTTCTCGAGAAAGTTGCCTTGTCGTCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-456s1c1
Sequence:CCGGCAGGTGGATGTAGAGATCAAACTCGAGTTTGATCTCTACATCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013277
VALIDATED
RACGAP1 MISSION shRNA shRNA Plasmid DNA
Rac GTPase activating protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-2165s21c1
Sequence:CCGGCTAGGACGACAAGGCAACTTTCTCGAGAAAGTTGCCTTGTCGTCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-1161s21c1
Sequence:CCGGTGCGCCTGCATGACTTTGTTTCTCGAGAAACAAAGTCATGCAGGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013277.3-542s21c1
Sequence:CCGGCAGGTGGATGTAGAGATCAAACTCGAGTTTGATCTCTACATCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-362s21c1
Sequence:CCGGCGGGTGGAGATTCTCAGTGAACTCGAGTTCACTGAGAATCTCCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-276s1c1
Sequence:CCGGCGGGTGGAGATTCTCAGTGAACTCGAGTTCACTGAGAATCTCCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-659s1c1
Sequence:CCGGCATTGATGAATCTGGTTCCATCTCGAGATGGAACCAGATTCATCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013277.2-1075s1c1
Sequence:CCGGTGCGCCTGCATGACTTTGTTTCTCGAGAAACAAAGTCATGCAGGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013277.2-2079s1c1
Sequence:CCGGCTAGGACGACAAGGCAACTTTCTCGAGAAAGTTGCCTTGTCGTCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-456s1c1
Sequence:CCGGCAGGTGGATGTAGAGATCAAACTCGAGTTTGATCTCTACATCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013277
VALIDATED
RACGAP1 MISSION shRNA Lentiviral Transduction Particles
Rac GTPase activating protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-2165s21c1
Sequence:CCGGCTAGGACGACAAGGCAACTTTCTCGAGAAAGTTGCCTTGTCGTCCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-1161s21c1
Sequence:CCGGTGCGCCTGCATGACTTTGTTTCTCGAGAAACAAAGTCATGCAGGCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013277.3-542s21c1
Sequence:CCGGCAGGTGGATGTAGAGATCAAACTCGAGTTTGATCTCTACATCCACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_013277.3-362s21c1
Sequence:CCGGCGGGTGGAGATTCTCAGTGAACTCGAGTTCACTGAGAATCTCCACCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-276s1c1
Sequence:CCGGCGGGTGGAGATTCTCAGTGAACTCGAGTTCACTGAGAATCTCCACCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-659s1c1
Sequence:CCGGCATTGATGAATCTGGTTCCATCTCGAGATGGAACCAGATTCATCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013277.2-1075s1c1
Sequence:CCGGTGCGCCTGCATGACTTTGTTTCTCGAGAAACAAAGTCATGCAGGCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013277.2-2079s1c1
Sequence:CCGGCTAGGACGACAAGGCAACTTTCTCGAGAAAGTTGCCTTGTCGTCCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013277.2-456s1c1
Sequence:CCGGCAGGTGGATGTAGAGATCAAACTCGAGTTTGATCTCTACATCCACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)