EMAIL THIS PAGE TO A FRIEND

RAD17

RAD17 homolog (S. pombe)

197 Gene Product Result for
Synonyms: CCYC HRAD17 R24L RAD17SP RAD24
Gene ID:
Human(5884) Summary: The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
Mouse(19356) RAD17 homolog (S. pombe)
Rat(310034) RAD17 homolog (S. pombe)
cow(513600) RAD17 homolog (S. pombe)
sheep(101118988) RAD17 homolog (S. pombe)
domestic guinea pig(100726505) RAD17 homolog (S. pombe)
naked mole-rat(101720200) RAD17 homolog (S. pombe)
Domestic Rabbit(100339735) RAD17 homolog (S. pombe)
fruit fly(41779) CG7825 gene product from transcript CG7825-RA
Horse(100065769) RAD17 homolog (S. pombe)
domestic cat(101087298) RAD17 homolog (S. pombe)
dog(478088) RAD17 homolog (S. pombe)
Zebrafish(436934) RAD17 homolog (S. pombe)
chicken(404778) RAD17 homolog (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503832 Anti-phospho-RAD17 (pSer645) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
R8029 Anti-RAD17 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
R8654 Anti-RAD17 (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat, mouse
immunoprecipitation (IP), western blot pricing
SAB1406363 Anti-RAD17 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA005448 Anti-RAD17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV30206 Anti-RAD17 antibody produced in rabbit IgG fraction of antiserum mouse, pig, rat, canine, human, bovine
western blot pricing
SAB4502561 Anti-RAD17 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0051 Goat anti-Rad17 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, human, marmoset
proximity ligation assay, western blot pricing
WH0005884M1 Monoclonal Anti-RAD17 antibody produced in mouse clone 2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0052 Rabbit anti-Phospho Rad17 (S645) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, primate, rhesus monkey, gibbon, marmoset, African green monkey, chimpanzee, human
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002873 Rosetta Predictions human pricing
NM_133338 Rosetta Predictions human pricing
NM_133339 Rosetta Predictions human pricing
NM_133340 Rosetta Predictions human pricing
NM_133341 Rosetta Predictions human pricing
NM_133342 Rosetta Predictions human pricing
NM_133343 Rosetta Predictions human pricing
NM_133344 Rosetta Predictions human pricing
NM_001024778 Rosetta Predictions rat pricing
NM_001044371 Rosetta Predictions mouse pricing
NM_011233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334646 predicted 1205
2 SASI_Hs01_00135102 predicted 2445
3 SASI_Hs01_00135103 predicted 2031
4 SASI_Hs01_00135104 predicted 2709
5 SASI_Hs01_00135105 predicted 2300
6 SASI_Hs02_00334647 predicted 1758
7 SASI_Hs01_00135106 predicted 1256
8 SASI_Hs01_00135107 predicted 2669
9 SASI_Hs02_00334648 predicted 2318
10 SASI_Hs01_00135108 predicted 2427
11 SASI_Hs01_00135109 predicted 2182
12 SASI_Hs01_00135110 predicted 1935
13 SASI_Hs01_00135111 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363037 predicted 1103
2 SASI_Hs01_00131277 predicted 2336
3 SASI_Hs01_00131278 predicted 1927
4 SASI_Hs01_00131279 predicted 2598
5 SASI_Hs01_00131280 predicted 2202
6 SASI_Hs02_00363038 predicted 1658
7 SASI_Hs01_00131281 predicted 1149
8 SASI_Hs01_00131282 predicted 2572
9 SASI_Hs02_00363039 predicted 2217
10 SASI_Hs01_00131283 predicted 2326
11 SASI_Hs01_00131284 predicted 2076
12 SASI_Hs01_00131285 predicted 1834
13 SASI_Hs01_00131286 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363040 predicted 660
2 SASI_Hs01_00231141 predicted 1893
3 SASI_Hs01_00231142 predicted 1490
4 SASI_Hs01_00231143 predicted 2157
5 SASI_Hs01_00231144 predicted 1753
6 SASI_Hs01_00231145 predicted 710
7 SASI_Hs02_00363041 predicted 1510
8 SASI_Hs01_00231146 predicted 2124
9 SASI_Hs02_00363042 predicted 1771
10 SASI_Hs01_00231147 predicted 1876
11 SASI_Hs01_00231148 predicted 1639
12 SASI_Hs01_00231149 predicted 1389
13 SASI_Hs01_00231150 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363043 predicted 689
2 SASI_Hs01_00079180 predicted 1931
3 SASI_Hs01_00079181 predicted 1521
4 SASI_Hs01_00079182 predicted 2194
5 SASI_Hs01_00079183 predicted 1792
6 SASI_Hs02_00363044 predicted 1249
7 SASI_Hs01_00079184 predicted 739
8 SASI_Hs01_00079185 predicted 2164
9 SASI_Hs02_00363045 predicted 1809
10 SASI_Hs01_00079186 predicted 1916
11 SASI_Hs01_00079187 predicted 1668
12 SASI_Hs01_00079188 predicted 1416
13 SASI_Hs01_00079189 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363046 predicted 615
2 SASI_Hs01_00027516 predicted 1859
3 SASI_Hs01_00027517 predicted 1446
4 SASI_Hs01_00027518 predicted 2122
5 SASI_Hs01_00027519 predicted 1713
6 SASI_Hs02_00363047 predicted 1174
7 SASI_Hs01_00027520 predicted 665
8 SASI_Hs01_00027521 predicted 2089
9 SASI_Hs02_00363048 predicted 1736
10 SASI_Hs01_00027522 predicted 1841
11 SASI_Hs01_00027523 predicted 1590
12 SASI_Hs01_00027524 predicted 1341
13 SASI_Hs01_00027525 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363049 predicted 996
2 SASI_Hs01_00151402 predicted 2236
3 SASI_Hs01_00151403 predicted 1827
4 SASI_Hs01_00151404 predicted 2498
5 SASI_Hs01_00151405 predicted 2093
6 SASI_Hs02_00363050 predicted 1549
7 SASI_Hs01_00151406 predicted 1053
8 SASI_Hs01_00151407 predicted 2467
9 SASI_Hs02_00363051 predicted 2109
10 SASI_Hs01_00151408 predicted 2217
11 SASI_Hs01_00151409 predicted 1970
12 SASI_Hs01_00151410 predicted 1725
13 SASI_Hs01_00151411 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363052 predicted 1046
2 SASI_Hs01_00162696 predicted 2278
3 SASI_Hs01_00162697 predicted 1876
4 SASI_Hs01_00162698 predicted 2545
5 SASI_Hs01_00162699 predicted 2139
6 SASI_Hs02_00363053 predicted 1601
7 SASI_Hs01_00162700 predicted 1090
8 SASI_Hs01_00162701 predicted 2512
9 SASI_Hs02_00363054 predicted 2157
10 SASI_Hs01_00162702 predicted 2263
11 SASI_Hs01_00162703 predicted 2016
12 SASI_Hs01_00162704 predicted 1775
13 SASI_Hs01_00162705 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363055 predicted 863
2 SASI_Hs01_00230462 predicted 2099
3 SASI_Hs01_00230463 predicted 1686
4 SASI_Hs01_00230464 predicted 2362
5 SASI_Hs01_00230465 predicted 1958
6 SASI_Hs02_00363056 predicted 1420
7 SASI_Hs01_00230466 predicted 909
8 SASI_Hs01_00230467 predicted 2331
9 SASI_Hs02_00363057 predicted 1971
10 SASI_Hs01_00230468 predicted 2086
11 SASI_Hs01_00230469 predicted 1833
12 SASI_Hs01_00230470 predicted 1586
13 SASI_Hs01_00230471 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109926 predicted 814
2 SASI_Rn01_00109928 predicted 1674
3 SASI_Rn01_00109929 predicted 1978
4 SASI_Rn01_00109930 predicted 578
5 SASI_Rn01_00109931 predicted 1036
6 SASI_Rn01_00109932 predicted 1247
7 SASI_Rn01_00109933 predicted 1095
8 SASI_Rn01_00109934 predicted 1001
9 SASI_Rn01_00109935 predicted 909
10 SASI_Rn02_00202671 predicted 865
11 SASI_Rn01_00109927 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291224 predicted 2250
2 SASI_Mm02_00291225 predicted 685
3 SASI_Mm02_00291226 predicted 1592
4 SASI_Mm02_00291227 predicted 1627
5 SASI_Mm02_00291228 predicted 691
6 SASI_Mm02_00291229 predicted 1714
7 SASI_Mm02_00291230 predicted 2321
8 SASI_Mm02_00291231 predicted 756
9 SASI_Mm02_00291232 predicted 631
10 SASI_Mm02_00291233 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098033 predicted 2370
2 SASI_Mm01_00098034 predicted 813
3 SASI_Mm01_00098035 predicted 1725
4 SASI_Mm01_00098036 predicted 1757
5 SASI_Mm01_00098037 predicted 820
6 SASI_Mm01_00098038 predicted 1836
7 SASI_Mm01_00098039 predicted 2450
8 SASI_Mm01_00098040 predicted 882
9 SASI_Mm02_00320199 predicted 759
10 SASI_Mm02_00320200 predicted 890
11 SASI_Mm01_00098041 predicted 1549
12 SASI_Mm01_00098042 predicted 1842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011233
VALIDATED
RAD17 MISSION shRNA Bacterial Glycerol Stock
RAD17 homolog (S. pombe)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-994s21c1
Sequence:CCGGTATCGAGACCCTAACGCTTTACTCGAGTAAAGCGTTAGGGTCTCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-410s21c1
Sequence:CCGGCGTCATCTTTAACTTTCAGTACTCGAGTACTGAAAGTTAAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011233.2-1168s21c1
Sequence:CCGGGCACCAACAATTATGATGAAACTCGAGTTTCATCATAATTGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-1998s21c1
Sequence:CCGGGACCATTCCAATGCGAAATAACTCGAGTTATTTCGCATTGGAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011233.2-2435s21c1
Sequence:CCGGCGTCTCTGAAGGACAAGCAATCTCGAGATTGCTTGTCCTTCAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011233.1-2207s1c1
Sequence:CCGGCGTCTCTGAAGGACAAGCAATCTCGAGATTGCTTGTCCTTCAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-943s1c1
Sequence:CCGGGCACCAACAATTATGATGAAACTCGAGTTTCATCATAATTGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-1531s1c1
Sequence:CCGGCGCTCGTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAACGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-185s1c1
Sequence:CCGGCGTCATCTTTAACTTTCAGTACTCGAGTACTGAAAGTTAAAGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-1532s1c1
Sequence:CCGGGCTCGTTACTCAGGGAATATACTCGAGTATATTCCCTGAGTAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011233
VALIDATED
RAD17 MISSION shRNA shRNA Plasmid DNA
RAD17 homolog (S. pombe)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-994s21c1
Sequence:CCGGTATCGAGACCCTAACGCTTTACTCGAGTAAAGCGTTAGGGTCTCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-410s21c1
Sequence:CCGGCGTCATCTTTAACTTTCAGTACTCGAGTACTGAAAGTTAAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011233.2-1168s21c1
Sequence:CCGGGCACCAACAATTATGATGAAACTCGAGTTTCATCATAATTGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-1998s21c1
Sequence:CCGGGACCATTCCAATGCGAAATAACTCGAGTTATTTCGCATTGGAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011233.2-2435s21c1
Sequence:CCGGCGTCTCTGAAGGACAAGCAATCTCGAGATTGCTTGTCCTTCAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011233.1-2207s1c1
Sequence:CCGGCGTCTCTGAAGGACAAGCAATCTCGAGATTGCTTGTCCTTCAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-943s1c1
Sequence:CCGGGCACCAACAATTATGATGAAACTCGAGTTTCATCATAATTGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-1531s1c1
Sequence:CCGGCGCTCGTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAACGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-185s1c1
Sequence:CCGGCGTCATCTTTAACTTTCAGTACTCGAGTACTGAAAGTTAAAGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-1532s1c1
Sequence:CCGGGCTCGTTACTCAGGGAATATACTCGAGTATATTCCCTGAGTAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011233
VALIDATED
RAD17 MISSION shRNA Lentiviral Transduction Particles
RAD17 homolog (S. pombe)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-994s21c1
Sequence:CCGGTATCGAGACCCTAACGCTTTACTCGAGTAAAGCGTTAGGGTCTCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-410s21c1
Sequence:CCGGCGTCATCTTTAACTTTCAGTACTCGAGTACTGAAAGTTAAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011233.2-1168s21c1
Sequence:CCGGGCACCAACAATTATGATGAAACTCGAGTTTCATCATAATTGTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011233.2-1998s21c1
Sequence:CCGGGACCATTCCAATGCGAAATAACTCGAGTTATTTCGCATTGGAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011233.2-2435s21c1
Sequence:CCGGCGTCTCTGAAGGACAAGCAATCTCGAGATTGCTTGTCCTTCAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011233.1-2207s1c1
Sequence:CCGGCGTCTCTGAAGGACAAGCAATCTCGAGATTGCTTGTCCTTCAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-943s1c1
Sequence:CCGGGCACCAACAATTATGATGAAACTCGAGTTTCATCATAATTGTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-1531s1c1
Sequence:CCGGCGCTCGTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAACGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-185s1c1
Sequence:CCGGCGTCATCTTTAACTTTCAGTACTCGAGTACTGAAAGTTAAAGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011233.1-1532s1c1
Sequence:CCGGGCTCGTTACTCAGGGAATATACTCGAGTATATTCCCTGAGTAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133338
VALIDATED
RAD17 MISSION shRNA Bacterial Glycerol Stock
RAD17 homolog (S. pombe)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-2834s21c1
Sequence:CCGGCAAGATGTGAAGGACTAATTCCTCGAGGAATTAGTCCTTCACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-1964s21c1
Sequence:CCGGCGCTCTTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAAAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-2355s21c1
Sequence:CCGGCCCAGCTTAATGGAGGACATTCTCGAGAATGTCCTCCATTAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133338.1-1112s21c1
Sequence:CCGGGCGACAAAGTATAACAAGTTACTCGAGTAACTTGTTATACTTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-1762s21c1
Sequence:CCGGGCCCTCTCATTTATCAGAATACTCGAGTATTCTGATAAATGAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-2355s1c1
Sequence:CCGGCCCAGCTTAATGGAGGACATTCTCGAGAATGTCCTCCATTAAGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1762s1c1
Sequence:CCGGGCCCTCTCATTTATCAGAATACTCGAGTATTCTGATAAATGAGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1112s1c1
Sequence:CCGGGCGACAAAGTATAACAAGTTACTCGAGTAACTTGTTATACTTTGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133338.1-614s1c1
Sequence:CCGGGCCACATCATTAGGTGTGAATCTCGAGATTCACACCTAATGATGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1964s1c1
Sequence:CCGGCGCTCTTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAAAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133338
VALIDATED
RAD17 MISSION shRNA shRNA Plasmid DNA
RAD17 homolog (S. pombe)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-2834s21c1
Sequence:CCGGCAAGATGTGAAGGACTAATTCCTCGAGGAATTAGTCCTTCACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-1964s21c1
Sequence:CCGGCGCTCTTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAAAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-2355s21c1
Sequence:CCGGCCCAGCTTAATGGAGGACATTCTCGAGAATGTCCTCCATTAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133338.1-1112s21c1
Sequence:CCGGGCGACAAAGTATAACAAGTTACTCGAGTAACTTGTTATACTTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-1762s21c1
Sequence:CCGGGCCCTCTCATTTATCAGAATACTCGAGTATTCTGATAAATGAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-2355s1c1
Sequence:CCGGCCCAGCTTAATGGAGGACATTCTCGAGAATGTCCTCCATTAAGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1762s1c1
Sequence:CCGGGCCCTCTCATTTATCAGAATACTCGAGTATTCTGATAAATGAGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1112s1c1
Sequence:CCGGGCGACAAAGTATAACAAGTTACTCGAGTAACTTGTTATACTTTGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133338.1-614s1c1
Sequence:CCGGGCCACATCATTAGGTGTGAATCTCGAGATTCACACCTAATGATGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1964s1c1
Sequence:CCGGCGCTCTTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAAAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133338
VALIDATED
RAD17 MISSION shRNA Lentiviral Transduction Particles
RAD17 homolog (S. pombe)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-2834s21c1
Sequence:CCGGCAAGATGTGAAGGACTAATTCCTCGAGGAATTAGTCCTTCACATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-1964s21c1
Sequence:CCGGCGCTCTTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAAAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-2355s21c1
Sequence:CCGGCCCAGCTTAATGGAGGACATTCTCGAGAATGTCCTCCATTAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133338.1-1112s21c1
Sequence:CCGGGCGACAAAGTATAACAAGTTACTCGAGTAACTTGTTATACTTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_133338.1-1762s21c1
Sequence:CCGGGCCCTCTCATTTATCAGAATACTCGAGTATTCTGATAAATGAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-2355s1c1
Sequence:CCGGCCCAGCTTAATGGAGGACATTCTCGAGAATGTCCTCCATTAAGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1762s1c1
Sequence:CCGGGCCCTCTCATTTATCAGAATACTCGAGTATTCTGATAAATGAGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1112s1c1
Sequence:CCGGGCGACAAAGTATAACAAGTTACTCGAGTAACTTGTTATACTTTGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133338.1-614s1c1
Sequence:CCGGGCCACATCATTAGGTGTGAATCTCGAGATTCACACCTAATGATGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_133338.1-1964s1c1
Sequence:CCGGCGCTCTTTACTCAGGGAATATCTCGAGATATTCCCTGAGTAAAGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)