EMAIL THIS PAGE TO A FRIEND

RAD18

RAD18 homolog (S. cerevisiae)

88 Gene Product Result for
Synonyms: RNF73
UniProtKB ID: Q9NS91, Q58F55, Q9NRT6
Gene ID:
Human(56852) Summary: The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
Mouse(58186) RAD18 homolog (S. cerevisiae)
Rat(362412) RAD18 homolog (S. cerevisiae)
Zebrafish(393106) RAD18 homolog (S. cerevisiae)
chicken(416114) RAD18 homolog (S. cerevisiae)
Horse(100052645) RAD18 homolog (S. cerevisiae)
domestic cat(101081963) RAD18 homolog (S. cerevisiae)
dog(476544) RAD18 homolog (S. cerevisiae)
naked mole-rat(101717786) RAD18 homolog (S. cerevisiae)
domestic guinea pig(100720939) RAD18 homolog (S. cerevisiae)
cow(514440) RAD18 homolog (S. cerevisiae)
sheep(101106800) RAD18 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R2281 Anti-RAD18 (356-370) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
R2406 Anti-RAD18 (466-480) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV43266 Anti-RAD18 antibody produced in rabbit affinity isolated antibody mouse, canine, bovine, rat, rabbit, human, pig, horse, guinea pig
western blot pricing
HPA006716 Anti-RAD18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA008752 Anti-RAD18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1411113 Anti-RAD18 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
HPA006724 Anti-RAD18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0056852M1 Monoclonal Anti-RAD18 antibody produced in mouse clone 3H7, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405194 Monoclonal Anti-RAD18 antibody produced in mouse clone 2B9, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing
PLA0182 Rabbit anti-Rad18 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gibbon, human, chimpanzee, rat, gorilla, hamster, rhesus monkey, marmoset
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013431 MISSION® esiRNA esiRNA targeting human RAD18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020165 Rosetta Predictions human pricing
NM_001077673 Rosetta Predictions rat pricing
NM_021385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353071 predicted 709
2 SASI_Hs01_00117828 predicted 731
3 SASI_Hs02_00353072 predicted 709
4 SASI_Hs01_00117829 predicted 1328
5 SASI_Hs01_00117830 predicted 395
6 SASI_Hs01_00117831 predicted 1306
7 SASI_Hs01_00117832 predicted 1335
8 SASI_Hs01_00117833 predicted 1538
9 SASI_Hs01_00117835 predicted 346
10 SASI_Hs01_00117836 predicted 493
11 SASI_Hs01_00117834 predicted 481
12 SASI_Hs01_00117837 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207852 predicted 1348
2 SASI_Rn02_00207853 predicted 1365
3 SASI_Rn02_00207854 predicted 333
4 SASI_Rn02_00207855 predicted 264
5 SASI_Rn02_00207856 predicted 1306
6 SASI_Rn02_00207857 predicted 470
7 SASI_Rn02_00207858 predicted 374
8 SASI_Rn02_00207859 predicted 1048
9 SASI_Rn02_00207860 predicted 247
10 SASI_Rn02_00207861 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176279 predicted 773
2 SASI_Mm01_00176280 predicted 1287
3 SASI_Mm01_00176281 predicted 374
4 SASI_Mm01_00176282 predicted 430
5 SASI_Mm01_00176283 predicted 1283
6 SASI_Mm01_00176284 predicted 212
7 SASI_Mm01_00176285 predicted 564
8 SASI_Mm01_00176286 predicted 786
9 SASI_Mm01_00176287 predicted 396
10 SASI_Mm01_00176288 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020165
VALIDATED
RAD18 MISSION shRNA Bacterial Glycerol Stock
RAD18 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020165.x-932s1c1
Sequence:CCGGCAATGCCCAATGCGATGCTTTCTCGAGAAAGCATCGCATTGGGCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020165.x-648s1c1
Sequence:CCGGCCCTCGACATCCACTTTGAAACTCGAGTTTCAAAGTGGATGTCGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-159s1c1
Sequence:CCGGTGCTTCGAGTATTTCAACATTCTCGAGAATGTTGAAATACTCGAAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-1536s1c1
Sequence:CCGGGAACCAAGAAACAAGCGTAATCTCGAGATTACGCTTGTTTCTTGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-1649s1c1
Sequence:CCGGGCCCAAGGAAAGATGCTAAATCTCGAGATTTAGCATCTTTCCTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020165.3-1689s21c1
Sequence:CCGGTATTACGGTTAGCTGATATTCCTCGAGGAATATCAGCTAACCGTAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020165.3-1456s21c1
Sequence:CCGGGCCTGGGAAGCATCACATAAACTCGAGTTTATGTGATGCTTCCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020165.3-450s21c1
Sequence:CCGGAGCCTCCAGACAGTCTTTAAACTCGAGTTTAAAGACTGTCTGGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020165
VALIDATED
RAD18 MISSION shRNA shRNA Plasmid DNA
RAD18 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020165.x-932s1c1
Sequence:CCGGCAATGCCCAATGCGATGCTTTCTCGAGAAAGCATCGCATTGGGCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020165.x-648s1c1
Sequence:CCGGCCCTCGACATCCACTTTGAAACTCGAGTTTCAAAGTGGATGTCGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-159s1c1
Sequence:CCGGTGCTTCGAGTATTTCAACATTCTCGAGAATGTTGAAATACTCGAAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-1536s1c1
Sequence:CCGGGAACCAAGAAACAAGCGTAATCTCGAGATTACGCTTGTTTCTTGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-1649s1c1
Sequence:CCGGGCCCAAGGAAAGATGCTAAATCTCGAGATTTAGCATCTTTCCTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020165.3-1689s21c1
Sequence:CCGGTATTACGGTTAGCTGATATTCCTCGAGGAATATCAGCTAACCGTAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020165.3-1456s21c1
Sequence:CCGGGCCTGGGAAGCATCACATAAACTCGAGTTTATGTGATGCTTCCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020165.3-450s21c1
Sequence:CCGGAGCCTCCAGACAGTCTTTAAACTCGAGTTTAAAGACTGTCTGGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020165
VALIDATED
RAD18 MISSION shRNA Lentiviral Transduction Particles
RAD18 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020165.x-932s1c1
Sequence:CCGGCAATGCCCAATGCGATGCTTTCTCGAGAAAGCATCGCATTGGGCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020165.x-648s1c1
Sequence:CCGGCCCTCGACATCCACTTTGAAACTCGAGTTTCAAAGTGGATGTCGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-159s1c1
Sequence:CCGGTGCTTCGAGTATTTCAACATTCTCGAGAATGTTGAAATACTCGAAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-1536s1c1
Sequence:CCGGGAACCAAGAAACAAGCGTAATCTCGAGATTACGCTTGTTTCTTGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020165.x-1649s1c1
Sequence:CCGGGCCCAAGGAAAGATGCTAAATCTCGAGATTTAGCATCTTTCCTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020165.3-1689s21c1
Sequence:CCGGTATTACGGTTAGCTGATATTCCTCGAGGAATATCAGCTAACCGTAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020165.3-1456s21c1
Sequence:CCGGGCCTGGGAAGCATCACATAAACTCGAGTTTATGTGATGCTTCCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020165.3-450s21c1
Sequence:CCGGAGCCTCCAGACAGTCTTTAAACTCGAGTTTAAAGACTGTCTGGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021385
VALIDATED
RAD18 MISSION shRNA Bacterial Glycerol Stock
RAD18 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-213s1c1
Sequence:CCGGCCTGAGAAATAATCGCCTCTTCTCGAGAAGAGGCGATTATTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-1370s1c1
Sequence:CCGGCGGATGATTCTTCTAGTTGTACTCGAGTACAACTAGAAGAATCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-40s1c1
Sequence:CCGGGCGGTGATGAAGACAATAGATCTCGAGATCTATTGTCTTCATCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-1147s1c1
Sequence:CCGGCCGTCGATGAGAACAGATGAACTCGAGTTCATCTGTTCTCATCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021385.1-889s1c1
Sequence:CCGGGCTGCTGAAATCGTCCAAGAACTCGAGTTCTTGGACGATTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-40s21c1
Sequence:CCGGGCGGTGATGAAGACAATAGATCTCGAGATCTATTGTCTTCATCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-1370s21c1
Sequence:CCGGCGGATGATTCTTCTAGTTGTACTCGAGTACAACTAGAAGAATCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-1147s21c1
Sequence:CCGGCCGTCGATGAGAACAGATGAACTCGAGTTCATCTGTTCTCATCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-213s21c1
Sequence:CCGGCCTGAGAAATAATCGCCTCTTCTCGAGAAGAGGCGATTATTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021385
VALIDATED
RAD18 MISSION shRNA shRNA Plasmid DNA
RAD18 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-213s1c1
Sequence:CCGGCCTGAGAAATAATCGCCTCTTCTCGAGAAGAGGCGATTATTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-1370s1c1
Sequence:CCGGCGGATGATTCTTCTAGTTGTACTCGAGTACAACTAGAAGAATCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-40s1c1
Sequence:CCGGGCGGTGATGAAGACAATAGATCTCGAGATCTATTGTCTTCATCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-1147s1c1
Sequence:CCGGCCGTCGATGAGAACAGATGAACTCGAGTTCATCTGTTCTCATCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021385.1-889s1c1
Sequence:CCGGGCTGCTGAAATCGTCCAAGAACTCGAGTTCTTGGACGATTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-40s21c1
Sequence:CCGGGCGGTGATGAAGACAATAGATCTCGAGATCTATTGTCTTCATCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-1370s21c1
Sequence:CCGGCGGATGATTCTTCTAGTTGTACTCGAGTACAACTAGAAGAATCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-1147s21c1
Sequence:CCGGCCGTCGATGAGAACAGATGAACTCGAGTTCATCTGTTCTCATCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-213s21c1
Sequence:CCGGCCTGAGAAATAATCGCCTCTTCTCGAGAAGAGGCGATTATTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021385
VALIDATED
RAD18 MISSION shRNA Lentiviral Transduction Particles
RAD18 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-213s1c1
Sequence:CCGGCCTGAGAAATAATCGCCTCTTCTCGAGAAGAGGCGATTATTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-1370s1c1
Sequence:CCGGCGGATGATTCTTCTAGTTGTACTCGAGTACAACTAGAAGAATCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-40s1c1
Sequence:CCGGGCGGTGATGAAGACAATAGATCTCGAGATCTATTGTCTTCATCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021385.1-1147s1c1
Sequence:CCGGCCGTCGATGAGAACAGATGAACTCGAGTTCATCTGTTCTCATCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021385.1-889s1c1
Sequence:CCGGGCTGCTGAAATCGTCCAAGAACTCGAGTTCTTGGACGATTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-40s21c1
Sequence:CCGGGCGGTGATGAAGACAATAGATCTCGAGATCTATTGTCTTCATCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-1370s21c1
Sequence:CCGGCGGATGATTCTTCTAGTTGTACTCGAGTACAACTAGAAGAATCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-1147s21c1
Sequence:CCGGCCGTCGATGAGAACAGATGAACTCGAGTTCATCTGTTCTCATCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021385.1-213s21c1
Sequence:CCGGCCTGAGAAATAATCGCCTCTTCTCGAGAAGAGGCGATTATTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)