EMAIL THIS PAGE TO A FRIEND

RAD1

RAD1 homolog (S. pombe)

68 Gene Product Result for
Synonyms: HRAD1 REC1
Gene ID:
Human(5810) Summary: This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]
Mouse(19355) RAD1 homolog (S. pombe)
Rat(294800) RAD1 homolog (S. pombe)
fruit fly(33440) Radiation insensitive 1
domestic cat(101080512) RAD1 homolog (S. pombe)
chicken(427432) RAD1 homolog (S. pombe)
dog(479366) RAD1 homolog (S. pombe)
Zebrafish(393872) RAD1 homolog (S. pombe)
naked mole-rat(101715088) RAD1 homolog (S. pombe)
domestic guinea pig(100714852) RAD1 homolog (S. pombe)
cow(518502) RAD1 homolog (S. pombe)
sheep(101112421) RAD1 homolog (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002853 Rosetta Predictions human pricing
NM_133377 Rosetta Predictions human pricing
NM_001106419 Rosetta Predictions rat pricing
NM_011232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246952 predicted 1214
2 SASI_Hs01_00246953 predicted 1200
3 SASI_Hs02_00334596 predicted 1138
4 SASI_Hs01_00246954 predicted 1019
5 SASI_Hs02_00334597 predicted 341
6 SASI_Hs01_00246955 predicted 615
7 SASI_Hs02_00334598 predicted 1040
8 SASI_Hs01_00246956 predicted 1030
9 SASI_Hs01_00246957 predicted 992
10 SASI_Hs02_00334599 predicted 403
11 SASI_Hs01_00246951 predicted 849
12 SASI_Hs01_00246958 predicted 415
13 SASI_Hs01_00246959 predicted 660
14 SASI_Hs01_00246960 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114567 predicted 1289
2 SASI_Hs01_00114568 predicted 1281
3 SASI_Hs02_00363087 predicted 1227
4 SASI_Hs01_00114569 predicted 1105
5 SASI_Hs02_00363088 predicted 430
6 SASI_Hs01_00114570 predicted 699
7 SASI_Hs02_00363089 predicted 1128
8 SASI_Hs01_00114571 predicted 1112
9 SASI_Hs01_00114572 predicted 1067
10 SASI_Hs02_00363090 predicted 493
11 SASI_Hs01_00114566 predicted 926
12 SASI_Hs01_00114573 predicted 491
13 SASI_Hs01_00114574 predicted 742
14 SASI_Hs01_00114575 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218778 predicted 969
2 SASI_Rn02_00218779 predicted 496
3 SASI_Rn02_00218780 predicted 897
4 SASI_Rn02_00218781 predicted 494
5 SASI_Rn02_00218782 predicted 932
6 SASI_Rn02_00218783 predicted 514
7 SASI_Rn02_00218784 predicted 452
8 SASI_Rn02_00218785 predicted 336
9 SASI_Rn02_00218786 predicted 347
10 SASI_Rn02_00218787 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320189 predicted 914
2 SASI_Mm02_00320190 predicted 604
3 SASI_Mm02_00320191 predicted 808
4 SASI_Mm02_00320192 predicted 314
5 SASI_Mm02_00320193 predicted 883
6 SASI_Mm02_00320194 predicted 646
7 SASI_Mm02_00320195 predicted 327
8 SASI_Mm02_00320196 predicted 334
9 SASI_Mm02_00320197 predicted 849
10 SASI_Mm02_00320198 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002853
VALIDATED
RAD1 MISSION shRNA Bacterial Glycerol Stock
RAD1 homolog (S. pombe)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002853.3-1305s21c1
Sequence:CCGGGCAAGGTCATGTACCCTAATACTCGAGTATTAGGGTACATGACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-771s21c1
Sequence:CCGGTGCAGCACCAATGTTATTAATCTCGAGATTAATAACATTGGTGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-447s21c1
Sequence:CCGGGCCACGTGTTTCGCAACTAAACTCGAGTTTAGTTGCGAAACACGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-881s21c1
Sequence:CCGGCAAGCCTTATTTCAGGTTATCCTCGAGGATAACCTGAAATAAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002853.3-1038s21c1
Sequence:CCGGCTATCTTGTAAGGTATCTATTCTCGAGAATAGATACCTTACAAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002853
VALIDATED
RAD1 MISSION shRNA shRNA Plasmid DNA
RAD1 homolog (S. pombe)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002853.3-1305s21c1
Sequence:CCGGGCAAGGTCATGTACCCTAATACTCGAGTATTAGGGTACATGACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-771s21c1
Sequence:CCGGTGCAGCACCAATGTTATTAATCTCGAGATTAATAACATTGGTGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-447s21c1
Sequence:CCGGGCCACGTGTTTCGCAACTAAACTCGAGTTTAGTTGCGAAACACGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-881s21c1
Sequence:CCGGCAAGCCTTATTTCAGGTTATCCTCGAGGATAACCTGAAATAAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002853.3-1038s21c1
Sequence:CCGGCTATCTTGTAAGGTATCTATTCTCGAGAATAGATACCTTACAAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002853
VALIDATED
RAD1 MISSION shRNA Lentiviral Transduction Particles
RAD1 homolog (S. pombe)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002853.3-1305s21c1
Sequence:CCGGGCAAGGTCATGTACCCTAATACTCGAGTATTAGGGTACATGACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-771s21c1
Sequence:CCGGTGCAGCACCAATGTTATTAATCTCGAGATTAATAACATTGGTGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-447s21c1
Sequence:CCGGGCCACGTGTTTCGCAACTAAACTCGAGTTTAGTTGCGAAACACGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002853.3-881s21c1
Sequence:CCGGCAAGCCTTATTTCAGGTTATCCTCGAGGATAACCTGAAATAAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002853.3-1038s21c1
Sequence:CCGGCTATCTTGTAAGGTATCTATTCTCGAGAATAGATACCTTACAAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133282
RAD1 MISSION shRNA Bacterial Glycerol Stock
RAD1 homolog (S. pombe)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-678s1c1
Sequence:CCGGGAATTGGATATGACGAGTGAACTCGAGTTCACTCGTCATATCCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-881s1c1
Sequence:CCGGCCTATCTTGTAAGGTATCTATCTCGAGATAGATACCTTACAAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-616s1c1
Sequence:CCGGGCAGCACCAATGTTATTAATACTCGAGTATTAATAACATTGGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-990s1c1
Sequence:CCGGCCTGATGAAGAAGTTCCTGAACTCGAGTTCAGGAACTTCTTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-827s1c1
Sequence:CCGGCCAAGTCAACAGATACAAGATCTCGAGATCTTGTATCTGTTGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133282
RAD1 MISSION shRNA shRNA Plasmid DNA
RAD1 homolog (S. pombe)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-678s1c1
Sequence:CCGGGAATTGGATATGACGAGTGAACTCGAGTTCACTCGTCATATCCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-881s1c1
Sequence:CCGGCCTATCTTGTAAGGTATCTATCTCGAGATAGATACCTTACAAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-616s1c1
Sequence:CCGGGCAGCACCAATGTTATTAATACTCGAGTATTAATAACATTGGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-990s1c1
Sequence:CCGGCCTGATGAAGAAGTTCCTGAACTCGAGTTCAGGAACTTCTTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-827s1c1
Sequence:CCGGCCAAGTCAACAGATACAAGATCTCGAGATCTTGTATCTGTTGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133282
RAD1 MISSION shRNA Lentiviral Transduction Particles
RAD1 homolog (S. pombe)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-678s1c1
Sequence:CCGGGAATTGGATATGACGAGTGAACTCGAGTTCACTCGTCATATCCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-881s1c1
Sequence:CCGGCCTATCTTGTAAGGTATCTATCTCGAGATAGATACCTTACAAGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-616s1c1
Sequence:CCGGGCAGCACCAATGTTATTAATACTCGAGTATTAATAACATTGGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-990s1c1
Sequence:CCGGCCTGATGAAGAAGTTCCTGAACTCGAGTTCAGGAACTTCTTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133282.1-827s1c1
Sequence:CCGGCCAAGTCAACAGATACAAGATCTCGAGATCTTGTATCTGTTGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011232
RAD1 MISSION shRNA Bacterial Glycerol Stock
RAD1 homolog (S. pombe)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-497s1c1
Sequence:CCGGCGGATGTGTTACCAAGGTTATCTCGAGATAACCTTGGTAACACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-615s1c1
Sequence:CCGGGCAGCACCAATGTTATGAATACTCGAGTATTCATAACATTGGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011232.1-1185s1c1
Sequence:CCGGCCGGCGAATATTTGTGTCTTTCTCGAGAAAGACACAAATATTCGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-371s1c1
Sequence:CCGGGCTGACGTGTTTCAGGAATTTCTCGAGAAATTCCTGAAACACGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-872s1c1
Sequence:CCGGGCACTAGCTTTATCCTGTAAACTCGAGTTTACAGGATAAAGCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011232
RAD1 MISSION shRNA shRNA Plasmid DNA
RAD1 homolog (S. pombe)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-497s1c1
Sequence:CCGGCGGATGTGTTACCAAGGTTATCTCGAGATAACCTTGGTAACACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-615s1c1
Sequence:CCGGGCAGCACCAATGTTATGAATACTCGAGTATTCATAACATTGGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011232.1-1185s1c1
Sequence:CCGGCCGGCGAATATTTGTGTCTTTCTCGAGAAAGACACAAATATTCGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-371s1c1
Sequence:CCGGGCTGACGTGTTTCAGGAATTTCTCGAGAAATTCCTGAAACACGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-872s1c1
Sequence:CCGGGCACTAGCTTTATCCTGTAAACTCGAGTTTACAGGATAAAGCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011232
RAD1 MISSION shRNA Lentiviral Transduction Particles
RAD1 homolog (S. pombe)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-497s1c1
Sequence:CCGGCGGATGTGTTACCAAGGTTATCTCGAGATAACCTTGGTAACACATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-615s1c1
Sequence:CCGGGCAGCACCAATGTTATGAATACTCGAGTATTCATAACATTGGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011232.1-1185s1c1
Sequence:CCGGCCGGCGAATATTTGTGTCTTTCTCGAGAAAGACACAAATATTCGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-371s1c1
Sequence:CCGGGCTGACGTGTTTCAGGAATTTCTCGAGAAATTCCTGAAACACGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011232.1-872s1c1
Sequence:CCGGGCACTAGCTTTATCCTGTAAACTCGAGTTTACAGGATAAAGCTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)